Incidental Mutation 'R1657:Rpap1'
ID 186443
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene Name RNA polymerase II associated protein 1
Synonyms A730023M06Rik, 1190005L06Rik
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119594440-119618018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119614259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 46 (D46G)
Ref Sequence ENSEMBL: ENSMUSP00000138619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
AlphaFold Q80TE0
Predicted Effect probably benign
Transcript: ENSMUST00000048493
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099529
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110793
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133146
Predicted Effect possibly damaging
Transcript: ENSMUST00000136419
AA Change: D46G

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156506
Predicted Effect probably benign
Transcript: ENSMUST00000184294
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Esam T C 9: 37,448,917 (GRCm39) S342P probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mroh2b A T 15: 4,960,525 (GRCm39) R753* probably null Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Nr2e3 T C 9: 59,856,050 (GRCm39) E129G probably benign Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Or8k27 A C 2: 86,275,562 (GRCm39) L255V probably damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp455 T C 13: 67,346,703 (GRCm39) F38S possibly damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119,613,189 (GRCm39) missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119,610,594 (GRCm39) missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119,613,135 (GRCm39) missense probably benign 0.02
IGL02100:Rpap1 APN 2 119,599,807 (GRCm39) missense probably benign 0.06
IGL02528:Rpap1 APN 2 119,605,431 (GRCm39) splice site probably null
IGL02530:Rpap1 APN 2 119,613,720 (GRCm39) splice site probably benign
IGL02747:Rpap1 APN 2 119,604,609 (GRCm39) missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119,605,538 (GRCm39) splice site probably benign
R0138:Rpap1 UTSW 2 119,595,380 (GRCm39) splice site probably null
R0325:Rpap1 UTSW 2 119,602,321 (GRCm39) missense probably benign
R0616:Rpap1 UTSW 2 119,608,601 (GRCm39) missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119,601,750 (GRCm39) missense probably damaging 1.00
R1837:Rpap1 UTSW 2 119,600,366 (GRCm39) critical splice donor site probably null
R2307:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2308:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2375:Rpap1 UTSW 2 119,600,888 (GRCm39) missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R2508:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R4155:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119,605,487 (GRCm39) missense probably benign 0.03
R4837:Rpap1 UTSW 2 119,608,732 (GRCm39) missense probably benign 0.32
R4880:Rpap1 UTSW 2 119,614,346 (GRCm39) missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119,600,522 (GRCm39) missense probably benign
R5111:Rpap1 UTSW 2 119,601,728 (GRCm39) missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119,604,331 (GRCm39) missense probably benign
R6144:Rpap1 UTSW 2 119,603,128 (GRCm39) nonsense probably null
R6353:Rpap1 UTSW 2 119,607,377 (GRCm39) splice site probably null
R6646:Rpap1 UTSW 2 119,610,612 (GRCm39) missense probably benign 0.03
R6731:Rpap1 UTSW 2 119,608,777 (GRCm39) missense probably benign
R6872:Rpap1 UTSW 2 119,605,850 (GRCm39) missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119,608,657 (GRCm39) missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119,604,043 (GRCm39) missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119,601,735 (GRCm39) missense probably benign
R7640:Rpap1 UTSW 2 119,594,891 (GRCm39) missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119,605,893 (GRCm39) critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119,595,284 (GRCm39) missense probably benign 0.13
R8934:Rpap1 UTSW 2 119,599,730 (GRCm39) critical splice donor site probably null
R9032:Rpap1 UTSW 2 119,608,776 (GRCm39) missense probably benign 0.00
R9220:Rpap1 UTSW 2 119,604,669 (GRCm39) missense probably damaging 0.99
R9422:Rpap1 UTSW 2 119,613,519 (GRCm39) intron probably benign
R9651:Rpap1 UTSW 2 119,598,484 (GRCm39) missense probably damaging 1.00
R9776:Rpap1 UTSW 2 119,607,278 (GRCm39) missense probably benign 0.00
X0028:Rpap1 UTSW 2 119,601,543 (GRCm39) missense probably benign
Z1177:Rpap1 UTSW 2 119,614,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCTTCATCGTGAGGCAGC -3'
(R):5'- GTACAAAGGGCACAGCTCCAGG -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- AGCTCCAGGGCCATGATG -3'
Posted On 2014-05-09