Mutagenetix > Incidental Mutations

Incidental Mutation 'R1657:Fer1l4'

186446

Institutional Source

Beutler Lab

Gene Symbol

Fer1l4

Ensembl Gene

ENSMUSG00000013338

Gene Name

fer-1-like 4 (C. elegans)

Synonyms

9130402C12Rik

MMRRC Submission

039693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1657 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

156019139-156052947 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 156035598 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1053 (V1053A)

Ref Sequence

ENSEMBL: ENSMUSP00000105240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000130764]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109611
AA Change: V1053A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: V1053A

Domain	Start	End	E-Value	Type
PDB:3L9B\|A	1	122	1e-12	PDB
Blast:C2	2	96	2e-51	BLAST
low complexity region	159	172	N/A	INTRINSIC
low complexity region	178	197	N/A	INTRINSIC
C2	228	329	2.87e-7	SMART
FerI	312	383	7.93e-29	SMART
C2	391	501	3.64e-9	SMART
low complexity region	574	581	N/A	INTRINSIC
low complexity region	611	622	N/A	INTRINSIC
low complexity region	829	837	N/A	INTRINSIC
low complexity region	844	855	N/A	INTRINSIC
FerB	861	932	7.27e-37	SMART
C2	968	1076	3.73e-6	SMART
low complexity region	1249	1257	N/A	INTRINSIC
low complexity region	1280	1310	N/A	INTRINSIC
low complexity region	1327	1340	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
C2	1449	1548	5.65e-15	SMART
C2	1692	1822	4.22e-5	SMART
Pfam:Ferlin_C	1834	1987	1.6e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130764

SMART Domains

Protein: ENSMUSP00000114324
Gene: ENSMUSG00000013338

Domain	Start	End	E-Value	Type
Blast:FerB	1	26	3e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000132912

SMART Domains

Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

Domain	Start	End	E-Value	Type
low complexity region	14	27	N/A	INTRINSIC
low complexity region	84	94	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150144

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150538

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Cgnl1	C	T	9: 71,725,944	V42I	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Dhx29	T	C	13: 112,952,843	I716T	probably damaging	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Grk3	A	G	5: 112,966,982	F124S	probably damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Lcn9	G	A	2: 25,824,710	E154K	probably benign	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Fer1l4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Fer1l4	APN	2	156019920	nonsense	probably null
IGL01025:Fer1l4	APN	2	156052185	missense	probably benign	0.41
IGL01103:Fer1l4	APN	2	156044441	critical splice donor site	probably null
IGL01322:Fer1l4	APN	2	156020339	splice site	probably null
IGL01391:Fer1l4	APN	2	156036456	missense	probably damaging	1.00
IGL02176:Fer1l4	APN	2	156048451	missense	probably benign
IGL02267:Fer1l4	APN	2	156031252	missense	possibly damaging	0.60
IGL02291:Fer1l4	APN	2	156019538	missense	probably damaging	1.00
IGL02385:Fer1l4	APN	2	156045428	missense	probably benign	0.04
IGL02423:Fer1l4	APN	2	156052907	missense	probably benign	0.04
IGL02596:Fer1l4	APN	2	156039132	missense	probably benign
IGL02612:Fer1l4	APN	2	156047928	missense	probably damaging	1.00
IGL02716:Fer1l4	APN	2	156029715	missense	probably damaging	1.00
IGL02738:Fer1l4	APN	2	156045728	missense	probably benign
IGL03035:Fer1l4	APN	2	156022606	missense	possibly damaging	0.95
IGL03083:Fer1l4	APN	2	156039366	unclassified	probably benign
IGL03201:Fer1l4	APN	2	156044730	missense	probably benign	0.32
IGL03349:Fer1l4	APN	2	156044734	nonsense	probably null
R0033:Fer1l4	UTSW	2	156024106	splice site	probably benign
R0356:Fer1l4	UTSW	2	156024010	missense	probably damaging	1.00
R0477:Fer1l4	UTSW	2	156052886	missense	probably benign	0.43
R0504:Fer1l4	UTSW	2	156052195	missense	probably benign	0.36
R0731:Fer1l4	UTSW	2	156024070	missense	probably benign	0.17
R0800:Fer1l4	UTSW	2	156045663	missense	possibly damaging	0.90
R0884:Fer1l4	UTSW	2	156019313	missense	possibly damaging	0.93
R1017:Fer1l4	UTSW	2	156049478	critical splice acceptor site	probably null
R1266:Fer1l4	UTSW	2	156046249	missense	possibly damaging	0.89
R1544:Fer1l4	UTSW	2	156045633	missense	probably benign	0.00
R1699:Fer1l4	UTSW	2	156029685	missense	probably benign	0.14
R1816:Fer1l4	UTSW	2	156035199	missense	probably damaging	0.98
R1950:Fer1l4	UTSW	2	156048274	missense	probably damaging	1.00
R2117:Fer1l4	UTSW	2	156039118	missense	probably benign	0.00
R2219:Fer1l4	UTSW	2	156031764	missense	probably damaging	0.99
R2220:Fer1l4	UTSW	2	156031764	missense	probably damaging	0.99
R2879:Fer1l4	UTSW	2	156052200	missense	probably damaging	1.00
R3746:Fer1l4	UTSW	2	156035048	missense	probably benign	0.01
R3806:Fer1l4	UTSW	2	156045683	missense	probably damaging	1.00
R3807:Fer1l4	UTSW	2	156045683	missense	probably damaging	1.00
R4224:Fer1l4	UTSW	2	156020389	missense	probably benign	0.37
R4274:Fer1l4	UTSW	2	156020544	missense	probably damaging	1.00
R4569:Fer1l4	UTSW	2	156036639	missense	possibly damaging	0.77
R4619:Fer1l4	UTSW	2	156047087	missense	probably damaging	1.00
R4707:Fer1l4	UTSW	2	156045623	missense	possibly damaging	0.69
R4914:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4915:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4917:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4918:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4941:Fer1l4	UTSW	2	156045089	missense	probably damaging	1.00
R5011:Fer1l4	UTSW	2	156031215	missense	probably damaging	1.00
R5013:Fer1l4	UTSW	2	156031215	missense	probably damaging	1.00
R5130:Fer1l4	UTSW	2	156049466	missense	possibly damaging	0.54
R5385:Fer1l4	UTSW	2	156037366	nonsense	probably null
R5441:Fer1l4	UTSW	2	156023257	missense	probably benign	0.00
R5555:Fer1l4	UTSW	2	156048189	missense	probably damaging	1.00
R5838:Fer1l4	UTSW	2	156051993	missense	probably benign	0.01
R6125:Fer1l4	UTSW	2	156046987	missense	probably damaging	1.00
R6184:Fer1l4	UTSW	2	156048291	missense	probably damaging	1.00
R6246:Fer1l4	UTSW	2	156024982	missense	probably damaging	0.99
R6248:Fer1l4	UTSW	2	156046171	missense	probably damaging	1.00
R6274:Fer1l4	UTSW	2	156029268	missense	probably damaging	1.00
R6298:Fer1l4	UTSW	2	156024740	missense	probably damaging	1.00
R6362:Fer1l4	UTSW	2	156048250	missense	probably benign	0.08
R6490:Fer1l4	UTSW	2	156047914	missense	possibly damaging	0.94
R6494:Fer1l4	UTSW	2	156045470	missense	probably benign	0.02
R6516:Fer1l4	UTSW	2	156035199	missense	probably damaging	0.98
R6530:Fer1l4	UTSW	2	156047865	critical splice donor site	probably null
R6740:Fer1l4	UTSW	2	156031222	missense	probably damaging	1.00
R7039:Fer1l4	UTSW	2	156036730	missense	probably benign	0.05
R7121:Fer1l4	UTSW	2	156044557	missense	probably benign	0.13
R7132:Fer1l4	UTSW	2	156045626	missense	probably damaging	0.98
R7382:Fer1l4	UTSW	2	156020749	nonsense	probably null
R7631:Fer1l4	UTSW	2	156048275	missense	probably damaging	1.00
R7693:Fer1l4	UTSW	2	156020431	missense	possibly damaging	0.51
R7730:Fer1l4	UTSW	2	156048934	missense	probably benign
R8021:Fer1l4	UTSW	2	156022591	missense	probably damaging	0.98
R8161:Fer1l4	UTSW	2	156024635	missense	probably benign	0.03
R8171:Fer1l4	UTSW	2	156048231	missense	probably benign	0.29
R8241:Fer1l4	UTSW	2	156049665	missense	probably benign
R8245:Fer1l4	UTSW	2	156045014	critical splice donor site	probably null
R8280:Fer1l4	UTSW	2	156049700	missense	probably damaging	1.00
R8369:Fer1l4	UTSW	2	156019760	missense	probably benign	0.17
R8403:Fer1l4	UTSW	2	156052243	missense	possibly damaging	0.88
RF030:Fer1l4	UTSW	2	156045529	small deletion	probably benign
X0063:Fer1l4	UTSW	2	156035011	missense	probably damaging	1.00
Z1177:Fer1l4	UTSW	2	156048429	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGGAGATACAGCCTGCCTGCC -3'
(R):5'- TGAAAGCATCCTATTGACTGCCCAC -3'

Sequencing Primer
(F):5'- CAGGCCAGGGTTCCTAAC -3'
(R):5'- tgcggcagaatgtctcac -3'

Posted On

2014-05-09