Mutagenetix > Incidental Mutations

Incidental Mutation 'R1657:Grk3'

186455

Institutional Source

Beutler Lab

Gene Symbol

Grk3

Ensembl Gene

ENSMUSG00000042249

Gene Name

G protein-coupled receptor kinase 3

Synonyms

4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2

MMRRC Submission

039693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1657 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

112910482-113015791 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112966982 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 124 (F124S)

Ref Sequence

ENSEMBL: ENSMUSP00000143427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065167
AA Change: F124S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: F124S

Domain	Start	End	E-Value	Type
RGS	54	175	1.44e-28	SMART
S_TKc	191	453	8.94e-85	SMART
S_TK_X	454	530	2.19e-10	SMART
PH	559	654	8.45e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000197776
AA Change: F124S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: F124S

Domain	Start	End	E-Value	Type
RGS	54	170	7.71e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000197888
AA Change: F82S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: F82S

Domain	Start	End	E-Value	Type
RGS	12	133	1.44e-28	SMART
S_TKc	149	411	8.94e-85	SMART
S_TK_X	412	488	2.19e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200332

SMART Domains

Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
PDB:3V5W\|A	1	88	6e-42	PDB
SCOP:d1dk8a_	48	88	2e-4	SMART
Blast:RGS	54	88	1e-18	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Cgnl1	C	T	9: 71,725,944	V42I	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Dhx29	T	C	13: 112,952,843	I716T	probably damaging	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Fer1l4	A	G	2: 156,035,598	V1053A	possibly damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Lcn9	G	A	2: 25,824,710	E154K	probably benign	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Grk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Grk3	APN	5	112985819	missense	probably damaging	1.00
IGL01359:Grk3	APN	5	112937760	missense	probably damaging	1.00
IGL02318:Grk3	APN	5	112937803	missense	probably damaging	1.00
IGL02612:Grk3	APN	5	112969234	missense	probably benign	0.27
R0142:Grk3	UTSW	5	112915053	missense	probably damaging	1.00
R0589:Grk3	UTSW	5	112928763	splice site	probably benign
R0607:Grk3	UTSW	5	112920053	missense	probably damaging	1.00
R1459:Grk3	UTSW	5	112915012	missense	probably benign	0.10
R1554:Grk3	UTSW	5	112969269	missense	possibly damaging	0.76
R1640:Grk3	UTSW	5	113015382	missense	probably benign	0.36
R1789:Grk3	UTSW	5	112941718	missense	probably damaging	1.00
R2401:Grk3	UTSW	5	112914983	missense	probably benign
R3735:Grk3	UTSW	5	112953831	missense	probably benign	0.00
R4024:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4025:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4392:Grk3	UTSW	5	112920136	missense	probably damaging	1.00
R4439:Grk3	UTSW	5	112946677	splice site	probably null
R4589:Grk3	UTSW	5	112941718	missense	possibly damaging	0.87
R4646:Grk3	UTSW	5	112929720	missense	probably benign	0.04
R5154:Grk3	UTSW	5	112941717	missense	probably damaging	1.00
R5462:Grk3	UTSW	5	112969208	missense	probably damaging	1.00
R5764:Grk3	UTSW	5	112966910	critical splice donor site	probably null
R5790:Grk3	UTSW	5	112966976	missense	possibly damaging	0.80
R6516:Grk3	UTSW	5	112961549	intron	probably benign
R6848:Grk3	UTSW	5	112985775	missense	probably damaging	0.98
R7857:Grk3	UTSW	5	112961561	missense	unknown
R7873:Grk3	UTSW	5	112929686	missense	probably benign	0.03
R8029:Grk3	UTSW	5	112961642	missense	probably benign
R8132:Grk3	UTSW	5	112961489	missense	unknown
RF021:Grk3	UTSW	5	112941688	missense	probably benign	0.20
Z1176:Grk3	UTSW	5	112957314	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGCAGAGAGCCATGCACATC -3'
(R):5'- TCAGGGGACCACTGTGTAAGACATC -3'

Sequencing Primer
(F):5'- GAGCCATGCACATCAGTATGTTAG -3'
(R):5'- GACCACTGTGTAAGACATCTGTTG -3'

Posted On

2014-05-09