Incidental Mutation 'R1657:Chd2'
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 039693-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73480430 bp
Amino Acid Change Tyrosine to Histidine at position 826 (Y826H)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
Predicted Effect probably damaging
Transcript: ENSMUST00000169922
AA Change: Y826H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: Y826H

low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199831
Predicted Effect probably benign
Transcript: ENSMUST00000200423
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
R7500:Chd2 UTSW 7 73451808 missense probably damaging 1.00
R7615:Chd2 UTSW 7 73441642 missense probably damaging 0.97
R7646:Chd2 UTSW 7 73435773 missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73471819 missense probably null 1.00
R7898:Chd2 UTSW 7 73519475 critical splice donor site probably null
R7935:Chd2 UTSW 7 73499625 missense probably benign 0.01
R8033:Chd2 UTSW 7 73435880 missense probably damaging 1.00
R8070:Chd2 UTSW 7 73451758 missense probably benign
R8071:Chd2 UTSW 7 73537384 missense probably benign
R8188:Chd2 UTSW 7 73429756 nonsense probably null
R8196:Chd2 UTSW 7 73468537 missense probably benign 0.00
R8258:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8259:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8357:Chd2 UTSW 7 73447237 missense probably damaging 0.99
RF009:Chd2 UTSW 7 73519662 missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Z1177:Chd2 UTSW 7 73468586 missense possibly damaging 0.48
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacagtggaaagagagaaatcaag -3'
Posted On2014-05-09