Incidental Mutation 'R1657:Nr2e3'
ID 186467
Institutional Source Beutler Lab
Gene Symbol Nr2e3
Ensembl Gene ENSMUSG00000032292
Gene Name nuclear receptor subfamily 2, group E, member 3
Synonyms RNR, Pnr, photoreceptor-specific nuclear receptor
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 59850054-59867942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59856050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 129 (E129G)
Ref Sequence ENSEMBL: ENSMUSP00000034831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034831]
AlphaFold Q9QXZ7
Predicted Effect probably benign
Transcript: ENSMUST00000034831
AA Change: E129G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034831
Gene: ENSMUSG00000032292
AA Change: E129G

DomainStartEndE-ValueType
ZnF_C4 37 109 1.26e-32 SMART
HOLI 209 367 3.92e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156845
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit rossettes and a reduced number of nuclei in the retinal outer nuclear layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Esam T C 9: 37,448,917 (GRCm39) S342P probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mroh2b A T 15: 4,960,525 (GRCm39) R753* probably null Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Or8k27 A C 2: 86,275,562 (GRCm39) L255V probably damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpap1 T C 2: 119,614,259 (GRCm39) D46G possibly damaging Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp455 T C 13: 67,346,703 (GRCm39) F38S possibly damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Nr2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Nr2e3 APN 9 59,856,291 (GRCm39) missense probably benign 0.14
R1448:Nr2e3 UTSW 9 59,850,797 (GRCm39) missense probably damaging 1.00
R1521:Nr2e3 UTSW 9 59,856,488 (GRCm39) missense probably damaging 0.99
R1819:Nr2e3 UTSW 9 59,850,720 (GRCm39) missense probably damaging 1.00
R1953:Nr2e3 UTSW 9 59,857,079 (GRCm39) missense probably benign 0.23
R3919:Nr2e3 UTSW 9 59,850,723 (GRCm39) missense probably damaging 1.00
R3925:Nr2e3 UTSW 9 59,855,716 (GRCm39) missense probably damaging 1.00
R4654:Nr2e3 UTSW 9 59,856,355 (GRCm39) intron probably benign
R5239:Nr2e3 UTSW 9 59,857,059 (GRCm39) splice site probably benign
R5310:Nr2e3 UTSW 9 59,856,617 (GRCm39) intron probably benign
R5586:Nr2e3 UTSW 9 59,856,484 (GRCm39) missense probably damaging 0.99
R5811:Nr2e3 UTSW 9 59,850,701 (GRCm39) small deletion probably benign
R5812:Nr2e3 UTSW 9 59,850,701 (GRCm39) small deletion probably benign
R5813:Nr2e3 UTSW 9 59,850,701 (GRCm39) small deletion probably benign
R7267:Nr2e3 UTSW 9 59,855,972 (GRCm39) missense possibly damaging 0.68
R7467:Nr2e3 UTSW 9 59,856,434 (GRCm39) splice site probably null
R7642:Nr2e3 UTSW 9 59,854,671 (GRCm39) missense possibly damaging 0.78
R7999:Nr2e3 UTSW 9 59,856,282 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCACAAGTTTCGGCGGTGATAAG -3'
(R):5'- AGGGCAAACATATCCCAAGTCAAGG -3'

Sequencing Primer
(F):5'- CGGCGGTGATAAGGCTGG -3'
(R):5'- ATCGCAATCAGTGCCAGG -3'
Posted On 2014-05-09