Mutagenetix > Incidental Mutations

Incidental Mutation 'R1657:Cgnl1'

186468

Institutional Source

Beutler Lab

Gene Symbol

Cgnl1

Ensembl Gene

ENSMUSG00000032232

Gene Name

cingulin-like 1

Synonyms

Jacop, 9930020M10Rik, 4933421H10Rik

MMRRC Submission

039693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1657 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71626509-71771602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 71725944 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 42 (V42I)

Ref Sequence

ENSEMBL: ENSMUSP00000112479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072899
AA Change: V42I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: V42I

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
low complexity region	728	739	N/A	INTRINSIC
Pfam:Myosin_tail_1	984	1255	5.4e-30	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121322
AA Change: V42I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: V42I

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
Pfam:Myosin_tail_1	909	1184	2.3e-30	PFAM
low complexity region	1187	1207	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122065
AA Change: V42I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: V42I

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
Pfam:Myosin_tail_1	582	1034	1.3e-12	PFAM
Pfam:Myosin_tail_1	1011	1253	7.7e-38	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Dhx29	T	C	13: 112,952,843	I716T	probably damaging	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Fer1l4	A	G	2: 156,035,598	V1053A	possibly damaging	Het
Grk3	A	G	5: 112,966,982	F124S	probably damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Lcn9	G	A	2: 25,824,710	E154K	probably benign	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Cgnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Cgnl1	APN	9	71656056	missense	probably benign	0.00
IGL01128:Cgnl1	APN	9	71724561	missense	possibly damaging	0.81
IGL01450:Cgnl1	APN	9	71631862	splice site	probably benign
IGL01788:Cgnl1	APN	9	71655390	missense	probably benign
IGL01806:Cgnl1	APN	9	71650322	missense	probably damaging	0.99
IGL01906:Cgnl1	APN	9	71724567	missense	probably benign	0.00
IGL01933:Cgnl1	APN	9	71645483	splice site	probably benign
IGL01939:Cgnl1	APN	9	71725004	missense	probably damaging	1.00
IGL01947:Cgnl1	APN	9	71725044	missense	probably damaging	0.99
IGL02127:Cgnl1	APN	9	71725853	missense	probably damaging	1.00
IGL02379:Cgnl1	APN	9	71645553	missense	possibly damaging	0.82
IGL02510:Cgnl1	APN	9	71725357	missense	probably benign	0.41
FR4548:Cgnl1	UTSW	9	71724717	small insertion	probably benign
R0058:Cgnl1	UTSW	9	71641397	missense	probably damaging	1.00
R0058:Cgnl1	UTSW	9	71724840	missense	probably damaging	0.99
R0105:Cgnl1	UTSW	9	71656102	missense	probably benign
R0220:Cgnl1	UTSW	9	71724943	missense	possibly damaging	0.68
R0242:Cgnl1	UTSW	9	71721657	missense	probably damaging	1.00
R0401:Cgnl1	UTSW	9	71705239	missense	probably damaging	1.00
R0541:Cgnl1	UTSW	9	71651253	missense	possibly damaging	0.54
R1018:Cgnl1	UTSW	9	71726058	missense	probably damaging	1.00
R1026:Cgnl1	UTSW	9	71717431	missense	possibly damaging	0.91
R1056:Cgnl1	UTSW	9	71725895	missense	probably damaging	1.00
R1299:Cgnl1	UTSW	9	71721712	splice site	probably benign
R1513:Cgnl1	UTSW	9	71724590	missense	probably benign	0.02
R1546:Cgnl1	UTSW	9	71725815	missense	probably benign
R1599:Cgnl1	UTSW	9	71641427	missense	probably benign	0.02
R1970:Cgnl1	UTSW	9	71725535	missense	probably benign	0.10
R2004:Cgnl1	UTSW	9	71630539	missense	probably damaging	1.00
R2080:Cgnl1	UTSW	9	71656096	missense	probably benign	0.01
R2085:Cgnl1	UTSW	9	71630878	missense	probably damaging	1.00
R2357:Cgnl1	UTSW	9	71725668	nonsense	probably null
R2402:Cgnl1	UTSW	9	71725179	missense	probably damaging	1.00
R3954:Cgnl1	UTSW	9	71724663	missense	probably benign	0.01
R4043:Cgnl1	UTSW	9	71705293	missense	probably damaging	1.00
R4127:Cgnl1	UTSW	9	71724540	missense	probably benign	0.00
R4825:Cgnl1	UTSW	9	71630524	missense	probably benign	0.00
R4851:Cgnl1	UTSW	9	71725032	missense	probably damaging	1.00
R4882:Cgnl1	UTSW	9	71717401	missense	probably benign	0.00
R4996:Cgnl1	UTSW	9	71724826	small deletion	probably benign
R5057:Cgnl1	UTSW	9	71724794	missense	probably damaging	0.99
R5263:Cgnl1	UTSW	9	71632654	nonsense	probably null
R5402:Cgnl1	UTSW	9	71629321	missense	probably damaging	1.00
R5744:Cgnl1	UTSW	9	71630675	splice site	probably null
R5770:Cgnl1	UTSW	9	71645487	splice site	probably null
R6911:Cgnl1	UTSW	9	71656215	missense	possibly damaging	0.82
R7014:Cgnl1	UTSW	9	71725134	missense	possibly damaging	0.86
R7106:Cgnl1	UTSW	9	71725733	missense	probably benign	0.00
R7203:Cgnl1	UTSW	9	71724533	missense	possibly damaging	0.80
R7231:Cgnl1	UTSW	9	71632645	missense	probably benign	0.39
R7241:Cgnl1	UTSW	9	71724770	missense	probably benign
R7288:Cgnl1	UTSW	9	71725564	missense	possibly damaging	0.67
R7327:Cgnl1	UTSW	9	71725883	missense	possibly damaging	0.48
R7390:Cgnl1	UTSW	9	71645649	missense	probably benign	0.04
R7529:Cgnl1	UTSW	9	71631758	missense	probably damaging	1.00
R7793:Cgnl1	UTSW	9	71725635	missense	probably damaging	1.00
R7975:Cgnl1	UTSW	9	71725322	missense	probably benign	0.00
R7990:Cgnl1	UTSW	9	71725265	missense	probably damaging	1.00
R8502:Cgnl1	UTSW	9	71630605	missense	probably damaging	0.99
R8926:Cgnl1	UTSW	9	71725253	missense	probably benign
R9010:Cgnl1	UTSW	9	71651349	missense	probably damaging	1.00
RF015:Cgnl1	UTSW	9	71724715	small insertion	probably benign
RF042:Cgnl1	UTSW	9	71724715	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CAACACGGTTCCATTGCTTGGATG -3'
(R):5'- TTTAACGGCTGGCAACCAGCAC -3'

Sequencing Primer
(F):5'- GATGTAGGGACAGGTTATTTATCAC -3'
(R):5'- AAGGATggcagggcagg -3'

Posted On

2014-05-09