Incidental Mutation 'R1657:Kif9'
ID186471
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Namekinesin family member 9
Synonyms
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110476958-110525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110489966 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 166 (M166T)
Ref Sequence ENSEMBL: ENSMUSP00000142689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198858]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061155
AA Change: M166T

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: M166T

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084952
AA Change: M166T

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: M166T

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197248
AA Change: M166T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: M166T

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198043
AA Change: M166T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489
AA Change: M166T

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198858
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 intron probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R7975:Kif9 UTSW 9 110514614 missense not run
R8050:Kif9 UTSW 9 110519140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATTCCCGTGCAGGTGTTCAG -3'
(R):5'- TGCCGAGCACATATGAAGCTCTC -3'

Sequencing Primer
(F):5'- GGATGATTGAAGAGCGTCCC -3'
(R):5'- gctctctgctcagtcccc -3'
Posted On2014-05-09