Incidental Mutation 'R1657:Zfp455'
ID 186484
Institutional Source Beutler Lab
Gene Symbol Zfp455
Ensembl Gene ENSMUSG00000051037
Gene Name zinc finger protein 455
Synonyms Rslcan-10, 3732412P20Rik
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 67342570-67357362 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67346703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 38 (F38S)
Ref Sequence ENSEMBL: ENSMUSP00000112546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117110] [ENSMUST00000120861]
AlphaFold Q7M6X9
Predicted Effect probably benign
Transcript: ENSMUST00000117110
SMART Domains Protein: ENSMUSP00000113356
Gene: ENSMUSG00000051037

DomainStartEndE-ValueType
ZnF_C2H2 44 66 7.15e-2 SMART
ZnF_C2H2 72 94 1.6e-4 SMART
ZnF_C2H2 100 122 2.12e-4 SMART
ZnF_C2H2 128 150 6.23e-2 SMART
ZnF_C2H2 184 206 1.01e-1 SMART
ZnF_C2H2 212 234 3.11e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 318 3.58e-2 SMART
ZnF_C2H2 324 346 2.24e-3 SMART
ZnF_C2H2 352 374 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120861
AA Change: F38S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112546
Gene: ENSMUSG00000051037
AA Change: F38S

DomainStartEndE-ValueType
KRAB 5 65 1.92e-34 SMART
ZnF_C2H2 109 131 7.15e-2 SMART
ZnF_C2H2 137 159 1.6e-4 SMART
ZnF_C2H2 165 187 2.12e-4 SMART
ZnF_C2H2 193 215 6.23e-2 SMART
ZnF_C2H2 249 271 1.01e-1 SMART
ZnF_C2H2 277 299 3.11e-2 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.58e-2 SMART
ZnF_C2H2 389 411 2.24e-3 SMART
ZnF_C2H2 417 439 7.9e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Esam T C 9: 37,448,917 (GRCm39) S342P probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mroh2b A T 15: 4,960,525 (GRCm39) R753* probably null Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Nr2e3 T C 9: 59,856,050 (GRCm39) E129G probably benign Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Or8k27 A C 2: 86,275,562 (GRCm39) L255V probably damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpap1 T C 2: 119,614,259 (GRCm39) D46G possibly damaging Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Zfp455
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zfp455 APN 13 67,355,962 (GRCm39) missense probably benign 0.33
IGL03111:Zfp455 APN 13 67,356,063 (GRCm39) missense probably benign 0.00
IGL03210:Zfp455 APN 13 67,355,113 (GRCm39) missense possibly damaging 0.93
IGL03371:Zfp455 APN 13 67,355,066 (GRCm39) nonsense probably null
PIT4504001:Zfp455 UTSW 13 67,346,685 (GRCm39) missense probably damaging 0.98
R0245:Zfp455 UTSW 13 67,355,899 (GRCm39) missense probably damaging 1.00
R0277:Zfp455 UTSW 13 67,346,728 (GRCm39) splice site probably null
R1141:Zfp455 UTSW 13 67,346,655 (GRCm39) missense probably damaging 1.00
R1266:Zfp455 UTSW 13 67,355,028 (GRCm39) nonsense probably null
R1749:Zfp455 UTSW 13 67,355,073 (GRCm39) missense probably damaging 1.00
R1757:Zfp455 UTSW 13 67,355,601 (GRCm39) missense probably damaging 1.00
R1854:Zfp455 UTSW 13 67,355,881 (GRCm39) missense probably damaging 1.00
R1867:Zfp455 UTSW 13 67,355,509 (GRCm39) missense probably benign 0.33
R4411:Zfp455 UTSW 13 67,355,389 (GRCm39) missense probably damaging 0.96
R6060:Zfp455 UTSW 13 67,355,257 (GRCm39) missense probably damaging 1.00
R6544:Zfp455 UTSW 13 67,355,121 (GRCm39) missense probably benign 0.33
R7132:Zfp455 UTSW 13 67,347,230 (GRCm39) missense probably damaging 1.00
R7524:Zfp455 UTSW 13 67,355,688 (GRCm39) missense possibly damaging 0.73
R7966:Zfp455 UTSW 13 67,347,302 (GRCm39) missense probably benign
R8848:Zfp455 UTSW 13 67,356,089 (GRCm39) missense possibly damaging 0.70
R8994:Zfp455 UTSW 13 67,355,478 (GRCm39) missense probably damaging 1.00
Z1176:Zfp455 UTSW 13 67,355,107 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTTACCAAAGTGCAGAGGAC -3'
(R):5'- CCTTCAAGGGTTTCTGACATGGACAG -3'

Sequencing Primer
(F):5'- tgtatgaccttgtgatctgacc -3'
(R):5'- GCCGGTGCATTTCTAACAG -3'
Posted On 2014-05-09