Mutagenetix > Incidental Mutation

Incidental Mutation 'R1657:Dhx29'

186486

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

039693-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1657 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112952843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 716 (I716T)

Ref Sequence

ENSEMBL: ENSMUSP00000035244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574]

AlphaFold

Q6PGC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000038574
AA Change: I716T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: I716T

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Cgnl1	C	T	9: 71,725,944	V42I	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Fer1l4	A	G	2: 156,035,598	V1053A	possibly damaging	Het
Grk3	A	G	5: 112,966,982	F124S	probably damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Lcn9	G	A	2: 25,824,710	E154K	probably benign	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	112947376	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5125:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	112940374	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	112964468	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7555:Dhx29	UTSW	13	112927642	start gained	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	112952884	missense	possibly damaging	0.54
R9281:Dhx29	UTSW	13	112941706	missense	possibly damaging	0.82
R9450:Dhx29	UTSW	13	112947328	missense	possibly damaging	0.78
R9496:Dhx29	UTSW	13	112952926	missense	probably damaging	1.00
R9716:Dhx29	UTSW	13	112945078	missense	possibly damaging	0.83
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTCCTAGTGTAGAGTCGGGCTTC -3'
(R):5'- GCAGGTGCCACCTTCAATCTGAAC -3'

Sequencing Primer
(F):5'- CTTGAGTCCTAAGGGAATAAATGTAG -3'
(R):5'- Tacacacacacacacacacac -3'

Posted On

2014-05-09