Incidental Mutation 'R1657:Mroh2b'
ID 186490
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 4928219-4991687 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 4960525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 753 (R753*)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably null
Transcript: ENSMUST00000045736
AA Change: R753*
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: R753*

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Esam T C 9: 37,448,917 (GRCm39) S342P probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Nr2e3 T C 9: 59,856,050 (GRCm39) E129G probably benign Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Or8k27 A C 2: 86,275,562 (GRCm39) L255V probably damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpap1 T C 2: 119,614,259 (GRCm39) D46G possibly damaging Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp455 T C 13: 67,346,703 (GRCm39) F38S possibly damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4,928,679 (GRCm39) missense probably benign
IGL00507:Mroh2b APN 15 4,991,609 (GRCm39) missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4,960,798 (GRCm39) missense probably benign 0.35
IGL00902:Mroh2b APN 15 4,944,704 (GRCm39) missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4,980,609 (GRCm39) splice site probably benign
IGL00954:Mroh2b APN 15 4,932,536 (GRCm39) missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4,971,024 (GRCm39) missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4,944,634 (GRCm39) missense probably benign 0.00
IGL01337:Mroh2b APN 15 4,934,506 (GRCm39) missense probably benign 0.38
IGL01780:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL01919:Mroh2b APN 15 4,953,170 (GRCm39) missense probably benign 0.10
IGL02069:Mroh2b APN 15 4,933,806 (GRCm39) splice site probably benign
IGL02146:Mroh2b APN 15 4,980,776 (GRCm39) splice site probably null
IGL02221:Mroh2b APN 15 4,953,123 (GRCm39) missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4,981,745 (GRCm39) missense probably benign 0.04
IGL02350:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02357:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02401:Mroh2b APN 15 4,929,983 (GRCm39) missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4,981,042 (GRCm39) splice site probably benign
IGL02432:Mroh2b APN 15 4,943,668 (GRCm39) missense probably benign
IGL02582:Mroh2b APN 15 4,937,997 (GRCm39) missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4,960,583 (GRCm39) missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4,935,114 (GRCm39) missense probably benign
IGL02811:Mroh2b APN 15 4,944,718 (GRCm39) missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4,991,630 (GRCm39) missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4,973,854 (GRCm39) missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4,942,294 (GRCm39) missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4,955,109 (GRCm39) missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4,960,600 (GRCm39) missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4,971,116 (GRCm39) missense probably benign 0.01
R0530:Mroh2b UTSW 15 4,963,877 (GRCm39) missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4,947,799 (GRCm39) missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4,978,137 (GRCm39) missense probably benign 0.00
R1525:Mroh2b UTSW 15 4,980,612 (GRCm39) splice site probably null
R1584:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4,974,572 (GRCm39) missense probably benign 0.08
R1671:Mroh2b UTSW 15 4,980,776 (GRCm39) splice site probably null
R1698:Mroh2b UTSW 15 4,943,622 (GRCm39) missense probably benign 0.02
R2002:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4,946,640 (GRCm39) missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4,974,448 (GRCm39) missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4,950,928 (GRCm39) critical splice donor site probably null
R2183:Mroh2b UTSW 15 4,947,707 (GRCm39) splice site probably null
R3713:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3714:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3747:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3748:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3749:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3750:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3792:Mroh2b UTSW 15 4,953,102 (GRCm39) missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4,954,543 (GRCm39) nonsense probably null
R4021:Mroh2b UTSW 15 4,954,582 (GRCm39) missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4,960,861 (GRCm39) missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4,977,407 (GRCm39) missense probably benign 0.21
R4592:Mroh2b UTSW 15 4,947,772 (GRCm39) missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4,933,752 (GRCm39) missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4,929,932 (GRCm39) missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4,971,004 (GRCm39) missense probably benign 0.07
R5342:Mroh2b UTSW 15 4,943,615 (GRCm39) nonsense probably null
R5353:Mroh2b UTSW 15 4,946,660 (GRCm39) missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4,935,054 (GRCm39) missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4,971,094 (GRCm39) missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4,938,463 (GRCm39) missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4,942,366 (GRCm39) splice site probably null
R6046:Mroh2b UTSW 15 4,980,763 (GRCm39) missense probably benign 0.01
R6081:Mroh2b UTSW 15 4,973,859 (GRCm39) missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4,944,707 (GRCm39) missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4,947,832 (GRCm39) missense probably benign 0.23
R6240:Mroh2b UTSW 15 4,964,126 (GRCm39) missense probably benign 0.38
R6487:Mroh2b UTSW 15 4,976,721 (GRCm39) missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4,935,056 (GRCm39) missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4,982,764 (GRCm39) missense probably benign 0.36
R6663:Mroh2b UTSW 15 4,977,417 (GRCm39) missense probably benign 0.21
R6820:Mroh2b UTSW 15 4,982,756 (GRCm39) missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4,938,469 (GRCm39) missense probably benign 0.00
R6990:Mroh2b UTSW 15 4,942,284 (GRCm39) missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4,929,986 (GRCm39) missense probably benign 0.35
R7092:Mroh2b UTSW 15 4,964,160 (GRCm39) missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4,977,485 (GRCm39) missense probably benign 0.06
R7264:Mroh2b UTSW 15 4,950,844 (GRCm39) missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4,971,036 (GRCm39) missense probably benign 0.21
R7462:Mroh2b UTSW 15 4,938,109 (GRCm39) missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4,978,491 (GRCm39) missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4,964,087 (GRCm39) missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4,960,543 (GRCm39) missense probably benign 0.09
R7605:Mroh2b UTSW 15 4,974,505 (GRCm39) missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4,946,613 (GRCm39) missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4,978,587 (GRCm39) missense probably benign 0.36
R7848:Mroh2b UTSW 15 4,967,861 (GRCm39) nonsense probably null
R7952:Mroh2b UTSW 15 4,980,693 (GRCm39) missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4,950,839 (GRCm39) nonsense probably null
R8088:Mroh2b UTSW 15 4,929,985 (GRCm39) missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4,967,892 (GRCm39) missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4,938,522 (GRCm39) missense probably benign 0.04
R8248:Mroh2b UTSW 15 4,960,586 (GRCm39) missense probably benign 0.40
R8258:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8259:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8304:Mroh2b UTSW 15 4,955,119 (GRCm39) missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4,980,746 (GRCm39) nonsense probably null
R8345:Mroh2b UTSW 15 4,973,808 (GRCm39) missense probably benign 0.09
R8507:Mroh2b UTSW 15 4,978,572 (GRCm39) missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4,935,122 (GRCm39) missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4,964,782 (GRCm39) missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4,978,191 (GRCm39) missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4,971,107 (GRCm39) missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4,960,510 (GRCm39) nonsense probably null
R8910:Mroh2b UTSW 15 4,960,855 (GRCm39) missense probably benign 0.01
R8913:Mroh2b UTSW 15 4,947,010 (GRCm39) intron probably benign
R8941:Mroh2b UTSW 15 4,991,606 (GRCm39) missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4,928,670 (GRCm39) start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4,982,754 (GRCm39) critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4,929,935 (GRCm39) missense probably benign 0.20
R9118:Mroh2b UTSW 15 4,991,573 (GRCm39) missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4,980,666 (GRCm39) missense probably benign
R9429:Mroh2b UTSW 15 4,963,907 (GRCm39) missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4,963,952 (GRCm39) missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4,973,821 (GRCm39) missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4,960,823 (GRCm39) missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4,950,845 (GRCm39) missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4,978,130 (GRCm39) missense probably benign 0.00
R9631:Mroh2b UTSW 15 4,946,556 (GRCm39) missense probably damaging 0.97
R9686:Mroh2b UTSW 15 4,974,605 (GRCm39) missense probably benign 0.34
R9774:Mroh2b UTSW 15 4,943,613 (GRCm39) missense probably benign 0.08
X0067:Mroh2b UTSW 15 4,981,073 (GRCm39) missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4,934,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGAAGTAGAAACCAATGCAGCAC -3'
(R):5'- TGCCTTCCATCAGAAAGATGCAAGAC -3'

Sequencing Primer
(F):5'- CCTCAAGGGGACCATTATATCAAG -3'
(R):5'- CATGTGTTTCATGATGGTGATGATG -3'
Posted On 2014-05-09