Incidental Mutation 'R1657:Vldlr'
ID186499
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27245670 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 747 (R747Q)
Ref Sequence ENSEMBL: ENSMUSP00000126730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably benign
Transcript: ENSMUST00000025866
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000047645
AA Change: R706Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: R706Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167487
AA Change: R747Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: R747Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172302
AA Change: R747Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: R747Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
disturbed UTSW 19 27238804 nonsense probably null
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
R8377:Vldlr UTSW 19 27234858 missense probably damaging 1.00
R8529:Vldlr UTSW 19 27230256 missense probably benign 0.03
R8777:Vldlr UTSW 19 27240546 missense probably benign 0.00
R8777-TAIL:Vldlr UTSW 19 27240546 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTAAGCTCCACAGAGACTACAGG -3'
(R):5'- TGAGCCCCAAAGCACAGATAGAATG -3'

Sequencing Primer
(F):5'- CTACAGGTAGTTAACACTACAGTGC -3'
(R):5'- TGAATGCCTGCTATACAACCG -3'
Posted On2014-05-09