Incidental Mutation 'R1658:Tubb1'
ID186512
Institutional Source Beutler Lab
Gene Symbol Tubb1
Ensembl Gene ENSMUSG00000016255
Gene Nametubulin, beta 1 class VI
Synonyms
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location174450695-174457882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 174456623 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 67 (D67A)
Ref Sequence ENSEMBL: ENSMUSP00000016399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016396] [ENSMUST00000016399]
Predicted Effect probably benign
Transcript: ENSMUST00000016396
SMART Domains Protein: ENSMUSP00000016396
Gene: ENSMUSG00000016252

DomainStartEndE-ValueType
Pfam:ATP-synt_Eps 2 51 7.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000016399
AA Change: D67A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016399
Gene: ENSMUSG00000016255
AA Change: D67A

DomainStartEndE-ValueType
Tubulin 47 244 3.42e-68 SMART
Tubulin_C 246 383 1.84e-41 SMART
low complexity region 433 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149191
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes have thrombocytopenia resulting from a defect in generating proplatelets. The platelets that are produced have structural and functional defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Tubb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Tubb1 APN 2 174456898 missense possibly damaging 0.87
IGL02534:Tubb1 APN 2 174455669 missense probably benign 0.04
IGL02535:Tubb1 APN 2 174457566 missense probably benign 0.00
IGL03404:Tubb1 APN 2 174457448 missense probably damaging 1.00
R0117:Tubb1 UTSW 2 174457784 missense probably benign 0.00
R0666:Tubb1 UTSW 2 174457755 missense probably damaging 0.98
R0939:Tubb1 UTSW 2 174455756 missense probably damaging 1.00
R1163:Tubb1 UTSW 2 174457739 missense probably benign
R1317:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1458:Tubb1 UTSW 2 174450803 critical splice donor site probably null
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1751:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1761:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1869:Tubb1 UTSW 2 174456689 missense probably benign 0.00
R1969:Tubb1 UTSW 2 174455691 missense possibly damaging 0.92
R2412:Tubb1 UTSW 2 174457110 missense possibly damaging 0.71
R4249:Tubb1 UTSW 2 174455733 missense probably null 0.93
R4415:Tubb1 UTSW 2 174457673 missense probably benign 0.12
R5154:Tubb1 UTSW 2 174456864 missense probably benign 0.19
R5276:Tubb1 UTSW 2 174457424 missense probably damaging 0.97
R5730:Tubb1 UTSW 2 174457769 missense probably benign
R6008:Tubb1 UTSW 2 174457774 missense probably benign 0.00
R6719:Tubb1 UTSW 2 174457394 missense probably damaging 1.00
R7422:Tubb1 UTSW 2 174457032 missense possibly damaging 0.76
X0063:Tubb1 UTSW 2 174457295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAGAAGATGTCCACTTACCAAAGGC -3'
(R):5'- AGAATGCACGATCTGGAAACCCTG -3'

Sequencing Primer
(F):5'- ACCTGCTGACTTGTTGCA -3'
(R):5'- GTTGTTACCAGCACCAGAGTTAC -3'
Posted On2014-05-09