Incidental Mutation 'R1658:Tbc1d2'
ID186514
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene NameTBC1 domain family, member 2
SynonymsPARIS-1, A630005A06Rik, LOC381605, PARIS1
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1658 (G1)
Quality Score165
Status Not validated
Chromosome4
Chromosomal Location46604390-46650209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46614207 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 625 (R625C)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621]
Predicted Effect probably damaging
Transcript: ENSMUST00000084621
AA Change: R625C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: R625C

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46649745 missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46616306 missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46607064 missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46649778 missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46620713 missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46649916 missense probably benign
IGL02571:Tbc1d2 APN 4 46628370 missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46637619 missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46620574 missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46649913 missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46649806 missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46609003 nonsense probably null
R1227:Tbc1d2 UTSW 4 46620629 missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1959:Tbc1d2 UTSW 4 46606419 missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46637652 missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46620484 missense probably benign 0.01
R4475:Tbc1d2 UTSW 4 46609080 missense possibly damaging 0.92
R5112:Tbc1d2 UTSW 4 46606503 missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46633639 intron probably benign
R5215:Tbc1d2 UTSW 4 46614006 missense probably benign 0.42
R5475:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5550:Tbc1d2 UTSW 4 46646138 missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46616298 missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46637715 missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46614068 missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6232:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46637692 missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6274:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46615045 missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46620736 missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46614420 missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46649712 missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46649965 missense probably benign 0.02
R7775:Tbc1d2 UTSW 4 46637746 splice site probably null
R7824:Tbc1d2 UTSW 4 46637746 splice site probably null
R8069:Tbc1d2 UTSW 4 46649737 missense possibly damaging 0.81
R8135:Tbc1d2 UTSW 4 46609071 missense probably benign 0.31
R8203:Tbc1d2 UTSW 4 46606476 missense probably damaging 1.00
R8271:Tbc1d2 UTSW 4 46649791 missense possibly damaging 0.88
R8690:Tbc1d2 UTSW 4 46615106 missense possibly damaging 0.95
X0023:Tbc1d2 UTSW 4 46615037 missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46606492 missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46650016 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCCTAAGACCCGCCAGACATTC -3'
(R):5'- TGCCAGACTACGAGATGGAAGACC -3'

Sequencing Primer
(F):5'- AAGAGAGGGCTGTGTTCTCAC -3'
(R):5'- CTACGAGATGGAAGACCTAAAACTG -3'
Posted On2014-05-09