Incidental Mutation 'R1658:Tmem38b'
ID186515
Institutional Source Beutler Lab
Gene Symbol Tmem38b
Ensembl Gene ENSMUSG00000028420
Gene Nametransmembrane protein 38B
Synonyms1600017F22Rik, TRIC-B, D4Ertd89e
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53826045-53862019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53840713 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 43 (M43V)
Ref Sequence ENSEMBL: ENSMUSP00000120304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030127] [ENSMUST00000144167]
Predicted Effect probably benign
Transcript: ENSMUST00000030127
AA Change: M67V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030127
Gene: ENSMUSG00000028420
AA Change: M67V

DomainStartEndE-ValueType
Pfam:TRIC 36 227 4.1e-81 PFAM
low complexity region 249 256 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144167
AA Change: M43V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120304
Gene: ENSMUSG00000028420
AA Change: M43V

DomainStartEndE-ValueType
Pfam:TRIC 9 164 3.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151206
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous null newborn mice die of respiratory failure showing atelectasis, pulmonary congestion, impaired maturation of alveolar type II cells, reduced lamellar body formation, abnormal synthesis and secretion of surfactant phospholipids, and impaired Ca2+ release in alveolar type II cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Tmem38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Tmem38b APN 4 53849024 missense probably damaging 1.00
IGL01948:Tmem38b APN 4 53850530 missense probably damaging 0.97
IGL02383:Tmem38b APN 4 53854345 missense probably benign
IGL02619:Tmem38b APN 4 53848871 missense probably damaging 1.00
R0266:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R0849:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R3845:Tmem38b UTSW 4 53859905 missense probably benign 0.10
R3930:Tmem38b UTSW 4 53854398 missense probably damaging 1.00
R4012:Tmem38b UTSW 4 53854409 missense probably benign 0.01
R4233:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R4235:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R5388:Tmem38b UTSW 4 53859945 missense probably benign 0.04
R5708:Tmem38b UTSW 4 53849051 critical splice donor site probably null
R6083:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R8272:Tmem38b UTSW 4 53854332 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAAGATCCTGACATCACCGCTG -3'
(R):5'- GGGTTCGTTCATTGCACATGCATTAAC -3'

Sequencing Primer
(F):5'- TGCCTGCATTGGAGAATACC -3'
(R):5'- TGCACATGCATTAACTTAAGGAC -3'
Posted On2014-05-09