Mutagenetix > Incidental Mutations

Incidental Mutation 'R1658:Chfr'

186523

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

039694-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R1658 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110153169 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 312 (I312T)

Ref Sequence

ENSEMBL: ENSMUSP00000143480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014812
AA Change: I384T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: I384T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112519
AA Change: I384T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: I384T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197968

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably damaging
Transcript: ENSMUST00000198633
AA Change: I312T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: I312T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200403

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,178,100	S604A	probably benign	Het
Apbb1	G	A	7: 105,574,084	P107S	probably damaging	Het
Baz2a	T	A	10: 128,124,383	M1489K	probably benign	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdca2	A	G	14: 67,677,699	S704P	possibly damaging	Het
Csmd1	A	G	8: 16,081,725	V1662A	possibly damaging	Het
Dgkd	T	A	1: 87,926,268	L611Q	probably damaging	Het
Dicer1	A	G	12: 104,700,414	V1376A	probably benign	Het
Elp2	C	T	18: 24,617,413	T269M	probably benign	Het
Ephb6	T	A	6: 41,614,245	V112E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Frem1	C	T	4: 83,001,808	R437Q	probably damaging	Het
G6pc2	A	T	2: 69,227,069	K353M	probably damaging	Het
Gabbr1	A	G	17: 37,047,507	T46A	probably damaging	Het
Gbp9	T	A	5: 105,094,468	Q135L	probably damaging	Het
Gstp1	A	T	19: 4,037,375	M20K	probably damaging	Het
Heatr6	A	G	11: 83,758,367	R183G	probably damaging	Het
Ints11	A	G	4: 155,887,728	K397E	probably damaging	Het
Intu	A	G	3: 40,692,781	T695A	probably benign	Het
Kif21b	T	C	1: 136,171,285	V1437A	probably damaging	Het
Klhl24	T	A	16: 20,107,092	Y123*	probably null	Het
Lipm	C	T	19: 34,116,447	L255F	probably benign	Het
Max	A	T	12: 76,938,581	M121K	probably benign	Het
Mga	A	T	2: 119,941,689	I1677L	possibly damaging	Het
Msantd1	C	A	5: 34,921,561	L147M	probably damaging	Het
Msantd1	T	A	5: 34,921,562	L147Q	probably benign	Het
Mylk4	T	C	13: 32,712,789	D363G	possibly damaging	Het
Naaa	T	C	5: 92,272,441		probably null	Het
Ninl	A	G	2: 150,964,159	Y381H	probably damaging	Het
Nwd2	A	G	5: 63,807,246	N1391S	probably damaging	Het
Olfr1537	C	T	9: 39,237,959	C155Y	probably benign	Het
Olfr421-ps1	G	A	1: 174,152,223	A236T	probably damaging	Het
Phip	A	G	9: 82,871,498	V1731A	probably benign	Het
Plxnb1	T	A	9: 109,102,871	C488*	probably null	Het
Rgs7	T	C	1: 175,079,554	I374V	probably benign	Het
Rin2	A	T	2: 145,876,456	M574L	probably benign	Het
Rps18	A	T	17: 33,952,418	D92E	probably benign	Het
Scrn1	T	A	6: 54,520,806	I267L	probably benign	Het
Stard9	T	C	2: 120,701,542	V67A	probably benign	Het
Syne1	T	G	10: 5,367,616	M493L	probably benign	Het
Tbc1d2	G	A	4: 46,614,207	R625C	probably damaging	Het
Tcerg1l	A	G	7: 138,394,180	S200P	probably damaging	Het
Tet3	A	T	6: 83,369,057	V1331E	probably benign	Het
Ticrr	A	T	7: 79,695,549	I1721F	possibly damaging	Het
Tjp2	T	C	19: 24,112,947	D577G	probably damaging	Het
Tmem2	T	C	19: 21,801,879	V351A	probably damaging	Het
Tmem38b	A	G	4: 53,840,713	M43V	probably benign	Het
Trabd	T	A	15: 89,085,866		probably null	Het
Trpv5	C	A	6: 41,674,282	D277Y	probably damaging	Het
Tubb1	A	C	2: 174,456,623	D67A	probably damaging	Het
Ubxn7	A	G	16: 32,381,236		probably null	Het
Ugp2	G	A	11: 21,333,774	P98S	probably benign	Het
Vmn2r66	G	T	7: 85,007,747	P150Q	probably benign	Het
Zbtb11	A	T	16: 55,974,225	H55L	possibly damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCATCATCTCTCTAGTCCTGTCC -3'
(R):5'- TATCCCCAGATCCCCATTTTCAGCCA -3'

Sequencing Primer
(F):5'- gcttcttgcctttcttcctctc -3'
(R):5'- ATTTTCAGCCAGGCACAGG -3'

Posted On

2014-05-09