Incidental Mutation 'R1658:Adgrd1'
ID186524
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Nameadhesion G protein-coupled receptor D1
SynonymsE230012M21Rik, Gpr133
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129096750-129204599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129178100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 604 (S604A)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
Predicted Effect probably benign
Transcript: ENSMUST00000056617
AA Change: S604A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: S604A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156437
AA Change: S572A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: S572A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTCTTTCTGTGAGGCAAGTCTTGG -3'
(R):5'- TGTCTAAAACCTGCTGACCCTACCC -3'

Sequencing Primer
(F):5'- CAAGTCTTGGAGGTTGGCATTAC -3'
(R):5'- CTGCACCTCAGATATGAAAGTG -3'
Posted On2014-05-09