Incidental Mutation 'R1658:Scrn1'
ID 186528
Institutional Source Beutler Lab
Gene Symbol Scrn1
Ensembl Gene ENSMUSG00000019124
Gene Name secernin 1
Synonyms 6330535A03Rik, SES1, 2810019K23Rik
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1658 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 54501173-54566489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54520806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 267 (I267L)
Ref Sequence ENSEMBL: ENSMUSP00000019268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019268]
AlphaFold Q9CZC8
Predicted Effect probably benign
Transcript: ENSMUST00000019268
AA Change: I267L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019268
Gene: ENSMUSG00000019124
AA Change: I267L

Pfam:Peptidase_C69 45 236 3.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203800
AA Change: I16L
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the secernin family of proteins. A similar protein in rat functions in regulation of exocytosis in mast cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Scrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Scrn1 APN 6 54520709 missense possibly damaging 0.92
IGL00937:Scrn1 APN 6 54520733 missense probably benign 0.02
IGL01568:Scrn1 APN 6 54522754 unclassified probably benign
IGL02572:Scrn1 APN 6 54512201 missense probably benign 0.01
IGL03251:Scrn1 APN 6 54548337 nonsense probably null
IGL03279:Scrn1 APN 6 54548337 nonsense probably null
IGL03301:Scrn1 APN 6 54548337 nonsense probably null
IGL03307:Scrn1 APN 6 54548337 nonsense probably null
R1583:Scrn1 UTSW 6 54520769 missense probably damaging 1.00
R1843:Scrn1 UTSW 6 54522841 missense possibly damaging 0.81
R2314:Scrn1 UTSW 6 54525646 missense probably benign 0.43
R4795:Scrn1 UTSW 6 54520769 missense possibly damaging 0.71
R4960:Scrn1 UTSW 6 54534422 missense probably damaging 1.00
R5420:Scrn1 UTSW 6 54512063 missense probably benign 0.15
R8057:Scrn1 UTSW 6 54520773 missense probably benign
R8340:Scrn1 UTSW 6 54534533 missense possibly damaging 0.81
R8544:Scrn1 UTSW 6 54522856 missense probably benign
R9465:Scrn1 UTSW 6 54525664 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaggaaaaaatgaaggacagaac -3'
Posted On 2014-05-09