Mutagenetix > Incidental Mutation

Incidental Mutation 'R1658:Ticrr'

186530

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

039694-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R1658 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79695549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1721 (I1721F)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: I1721F

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: I1721F

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059836

SMART Domains

Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178048

SMART Domains

Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183846

SMART Domains

Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184137

SMART Domains

Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,178,100	S604A	probably benign	Het
Apbb1	G	A	7: 105,574,084	P107S	probably damaging	Het
Baz2a	T	A	10: 128,124,383	M1489K	probably benign	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdca2	A	G	14: 67,677,699	S704P	possibly damaging	Het
Chfr	T	C	5: 110,153,169	I312T	probably damaging	Het
Csmd1	A	G	8: 16,081,725	V1662A	possibly damaging	Het
Dgkd	T	A	1: 87,926,268	L611Q	probably damaging	Het
Dicer1	A	G	12: 104,700,414	V1376A	probably benign	Het
Elp2	C	T	18: 24,617,413	T269M	probably benign	Het
Ephb6	T	A	6: 41,614,245	V112E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Frem1	C	T	4: 83,001,808	R437Q	probably damaging	Het
G6pc2	A	T	2: 69,227,069	K353M	probably damaging	Het
Gabbr1	A	G	17: 37,047,507	T46A	probably damaging	Het
Gbp9	T	A	5: 105,094,468	Q135L	probably damaging	Het
Gstp1	A	T	19: 4,037,375	M20K	probably damaging	Het
Heatr6	A	G	11: 83,758,367	R183G	probably damaging	Het
Ints11	A	G	4: 155,887,728	K397E	probably damaging	Het
Intu	A	G	3: 40,692,781	T695A	probably benign	Het
Kif21b	T	C	1: 136,171,285	V1437A	probably damaging	Het
Klhl24	T	A	16: 20,107,092	Y123*	probably null	Het
Lipm	C	T	19: 34,116,447	L255F	probably benign	Het
Max	A	T	12: 76,938,581	M121K	probably benign	Het
Mga	A	T	2: 119,941,689	I1677L	possibly damaging	Het
Msantd1	C	A	5: 34,921,561	L147M	probably damaging	Het
Msantd1	T	A	5: 34,921,562	L147Q	probably benign	Het
Mylk4	T	C	13: 32,712,789	D363G	possibly damaging	Het
Naaa	T	C	5: 92,272,441		probably null	Het
Ninl	A	G	2: 150,964,159	Y381H	probably damaging	Het
Nwd2	A	G	5: 63,807,246	N1391S	probably damaging	Het
Olfr1537	C	T	9: 39,237,959	C155Y	probably benign	Het
Olfr421-ps1	G	A	1: 174,152,223	A236T	probably damaging	Het
Phip	A	G	9: 82,871,498	V1731A	probably benign	Het
Plxnb1	T	A	9: 109,102,871	C488*	probably null	Het
Rgs7	T	C	1: 175,079,554	I374V	probably benign	Het
Rin2	A	T	2: 145,876,456	M574L	probably benign	Het
Rps18	A	T	17: 33,952,418	D92E	probably benign	Het
Scrn1	T	A	6: 54,520,806	I267L	probably benign	Het
Stard9	T	C	2: 120,701,542	V67A	probably benign	Het
Syne1	T	G	10: 5,367,616	M493L	probably benign	Het
Tbc1d2	G	A	4: 46,614,207	R625C	probably damaging	Het
Tcerg1l	A	G	7: 138,394,180	S200P	probably damaging	Het
Tet3	A	T	6: 83,369,057	V1331E	probably benign	Het
Tjp2	T	C	19: 24,112,947	D577G	probably damaging	Het
Tmem2	T	C	19: 21,801,879	V351A	probably damaging	Het
Tmem38b	A	G	4: 53,840,713	M43V	probably benign	Het
Trabd	T	A	15: 89,085,866		probably null	Het
Trpv5	C	A	6: 41,674,282	D277Y	probably damaging	Het
Tubb1	A	C	2: 174,456,623	D67A	probably damaging	Het
Ubxn7	A	G	16: 32,381,236		probably null	Het
Ugp2	G	A	11: 21,333,774	P98S	probably benign	Het
Vmn2r66	G	T	7: 85,007,747	P150Q	probably benign	Het
Zbtb11	A	T	16: 55,974,225	H55L	possibly damaging	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- ATTATCAAAGACTGGCCCCGCAGG -3'
(R):5'- AGTGTAGTCCCACAAGACTCCAGG -3'

Sequencing Primer
(F):5'- CAGGAAGAGGGCAGTGGATTG -3'
(R):5'- TCCCCTACTGAGTGGAGTG -3'

Posted On

2014-05-09