Incidental Mutation 'R1658:Max'
ID186545
Institutional Source Beutler Lab
Gene Symbol Max
Ensembl Gene ENSMUSG00000059436
Gene NameMax protein
SynonymsbHLHd6, bHLHd4, bHLHd8, bHLHd7, bHLHd5
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1658 (G1)
Quality Score170
Status Not validated
Chromosome12
Chromosomal Location76937269-76962201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76938581 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 121 (M121K)
Ref Sequence ENSEMBL: ENSMUSP00000151710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082136] [ENSMUST00000110395] [ENSMUST00000218640] [ENSMUST00000218653]
Predicted Effect probably benign
Transcript: ENSMUST00000082136
AA Change: M148K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080778
Gene: ENSMUSG00000059436
AA Change: M148K

DomainStartEndE-ValueType
HLH 20 71 1.56e-16 SMART
low complexity region 126 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110395
AA Change: M157K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106025
Gene: ENSMUSG00000059436
AA Change: M157K

DomainStartEndE-ValueType
HLH 29 80 1.56e-16 SMART
low complexity region 135 149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218597
Predicted Effect probably benign
Transcript: ENSMUST00000218640
AA Change: M121K

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218653
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a targeted mutation die between E5.5 and 6.5 displaying a generalized developmental arrest of both embryonic and extraembryonic tissues. These defects are not associated with inappropriate apoptosis, but rather with a failure of cellsto divide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Max
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Max APN 12 76938630 missense probably damaging 1.00
R0304:Max UTSW 12 76938587 missense probably benign 0.00
R1691:Max UTSW 12 76953272 missense possibly damaging 0.94
R7477:Max UTSW 12 76953186 missense probably benign 0.01
R7863:Max UTSW 12 76940074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTGTCCAAGAGCTTCTATGC -3'
(R):5'- GGAAGGGAATGACTTCTGAGCCAC -3'

Sequencing Primer
(F):5'- TCCAAGAGCTTCTATGCAAAAATAAC -3'
(R):5'- AAGGTGGTAACATGCTCCC -3'
Posted On2014-05-09