Incidental Mutation 'R1658:Dicer1'
ID186546
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Namedicer 1, ribonuclease type III
SynonymsD12Ertd7e
MMRRC Submission 039694-MU
Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104687742-104751952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104700414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1376 (V1376A)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
Predicted Effect probably benign
Transcript: ENSMUST00000041987
AA Change: V1376A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: V1376A

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104696772 missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104706327 missense probably null 0.75
IGL01527:Dicer1 APN 12 104691610 nonsense probably null
IGL01597:Dicer1 APN 12 104705210 nonsense probably null
IGL01636:Dicer1 APN 12 104722241 missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104702787 nonsense probably null
IGL01765:Dicer1 APN 12 104706740 missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104704180 missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104702553 missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104697020 missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104697035 missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104714832 missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104705129 missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104714906 missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104713107 missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104712197 missense probably damaging 0.98
everest UTSW 12 104705128 missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104696544 missense probably benign
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0219:Dicer1 UTSW 12 104692125 critical splice donor site probably null
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0385:Dicer1 UTSW 12 104704174 missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104731064 missense probably benign 0.04
R0426:Dicer1 UTSW 12 104702542 missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104702630 missense probably benign
R0502:Dicer1 UTSW 12 104705060 missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104691658 missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104702841 missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104702491 missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104706301 missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104706864 missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104706885 missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104691607 missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104729142 missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104729243 missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104721969 critical splice donor site probably null
R1642:Dicer1 UTSW 12 104713156 missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104708805 missense probably damaging 1.00
R1815:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104702884 missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104713214 missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104722031 missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104702949 missense probably benign 0.17
R2202:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2203:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2243:Dicer1 UTSW 12 104730188 missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104729228 missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104705114 missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104706277 missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104704751 nonsense probably null
R4776:Dicer1 UTSW 12 104692446 missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104696591 missense probably benign 0.44
R4904:Dicer1 UTSW 12 104713066 missense probably benign
R5202:Dicer1 UTSW 12 104694731 nonsense probably null
R5272:Dicer1 UTSW 12 104704240 missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104703151 missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104705128 missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104696462 missense probably benign 0.00
R6479:Dicer1 UTSW 12 104696723 missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104731023 missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104708849 missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104712278 missense probably benign
R7407:Dicer1 UTSW 12 104722351 nonsense probably null
R7471:Dicer1 UTSW 12 104694710 missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104706697 missense probably damaging 0.99
R7831:Dicer1 UTSW 12 104708800 missense probably damaging 1.00
R7914:Dicer1 UTSW 12 104708800 missense probably damaging 1.00
R7998:Dicer1 UTSW 12 104704069 missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104692132 missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104702818 nonsense probably null
X0018:Dicer1 UTSW 12 104696934 missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104731020 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- CACTCCAGCAAATGGCTAAGGCTAC -3'
(R):5'- GTATTGGCACACTGTATCTCCCAGC -3'

Sequencing Primer
(F):5'- CTATTTCTGAAGTCACAGACGGC -3'
(R):5'- CTTGGCAAGAAGAAGGGACT -3'
Posted On2014-05-09