Mutagenetix > Incidental Mutation

Incidental Mutation 'R1658:Dicer1'

186546

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

039694-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1658 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104700414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1376 (V1376A)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041987
AA Change: V1376A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: V1376A

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,178,100	S604A	probably benign	Het
Apbb1	G	A	7: 105,574,084	P107S	probably damaging	Het
Baz2a	T	A	10: 128,124,383	M1489K	probably benign	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdca2	A	G	14: 67,677,699	S704P	possibly damaging	Het
Chfr	T	C	5: 110,153,169	I312T	probably damaging	Het
Csmd1	A	G	8: 16,081,725	V1662A	possibly damaging	Het
Dgkd	T	A	1: 87,926,268	L611Q	probably damaging	Het
Elp2	C	T	18: 24,617,413	T269M	probably benign	Het
Ephb6	T	A	6: 41,614,245	V112E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Frem1	C	T	4: 83,001,808	R437Q	probably damaging	Het
G6pc2	A	T	2: 69,227,069	K353M	probably damaging	Het
Gabbr1	A	G	17: 37,047,507	T46A	probably damaging	Het
Gbp9	T	A	5: 105,094,468	Q135L	probably damaging	Het
Gstp1	A	T	19: 4,037,375	M20K	probably damaging	Het
Heatr6	A	G	11: 83,758,367	R183G	probably damaging	Het
Ints11	A	G	4: 155,887,728	K397E	probably damaging	Het
Intu	A	G	3: 40,692,781	T695A	probably benign	Het
Kif21b	T	C	1: 136,171,285	V1437A	probably damaging	Het
Klhl24	T	A	16: 20,107,092	Y123*	probably null	Het
Lipm	C	T	19: 34,116,447	L255F	probably benign	Het
Max	A	T	12: 76,938,581	M121K	probably benign	Het
Mga	A	T	2: 119,941,689	I1677L	possibly damaging	Het
Msantd1	C	A	5: 34,921,561	L147M	probably damaging	Het
Msantd1	T	A	5: 34,921,562	L147Q	probably benign	Het
Mylk4	T	C	13: 32,712,789	D363G	possibly damaging	Het
Naaa	T	C	5: 92,272,441		probably null	Het
Ninl	A	G	2: 150,964,159	Y381H	probably damaging	Het
Nwd2	A	G	5: 63,807,246	N1391S	probably damaging	Het
Olfr1537	C	T	9: 39,237,959	C155Y	probably benign	Het
Olfr421-ps1	G	A	1: 174,152,223	A236T	probably damaging	Het
Phip	A	G	9: 82,871,498	V1731A	probably benign	Het
Plxnb1	T	A	9: 109,102,871	C488*	probably null	Het
Rgs7	T	C	1: 175,079,554	I374V	probably benign	Het
Rin2	A	T	2: 145,876,456	M574L	probably benign	Het
Rps18	A	T	17: 33,952,418	D92E	probably benign	Het
Scrn1	T	A	6: 54,520,806	I267L	probably benign	Het
Stard9	T	C	2: 120,701,542	V67A	probably benign	Het
Syne1	T	G	10: 5,367,616	M493L	probably benign	Het
Tbc1d2	G	A	4: 46,614,207	R625C	probably damaging	Het
Tcerg1l	A	G	7: 138,394,180	S200P	probably damaging	Het
Tet3	A	T	6: 83,369,057	V1331E	probably benign	Het
Ticrr	A	T	7: 79,695,549	I1721F	possibly damaging	Het
Tjp2	T	C	19: 24,112,947	D577G	probably damaging	Het
Tmem2	T	C	19: 21,801,879	V351A	probably damaging	Het
Tmem38b	A	G	4: 53,840,713	M43V	probably benign	Het
Trabd	T	A	15: 89,085,866		probably null	Het
Trpv5	C	A	6: 41,674,282	D277Y	probably damaging	Het
Tubb1	A	C	2: 174,456,623	D67A	probably damaging	Het
Ubxn7	A	G	16: 32,381,236		probably null	Het
Ugp2	G	A	11: 21,333,774	P98S	probably benign	Het
Vmn2r66	G	T	7: 85,007,747	P150Q	probably benign	Het
Zbtb11	A	T	16: 55,974,225	H55L	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- CACTCCAGCAAATGGCTAAGGCTAC -3'
(R):5'- GTATTGGCACACTGTATCTCCCAGC -3'

Sequencing Primer
(F):5'- CTATTTCTGAAGTCACAGACGGC -3'
(R):5'- CTTGGCAAGAAGAAGGGACT -3'

Posted On

2014-05-09