Incidental Mutation 'R1658:Fbxo11'
ID186556
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene NameF-box protein 11
SynonymsJf, GENA 104
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87990859-88065291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88012658 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 209 (Y209N)
Ref Sequence ENSEMBL: ENSMUSP00000005504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
Predicted Effect probably benign
Transcript: ENSMUST00000005504
AA Change: Y209N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: Y209N

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130379
AA Change: Y133N
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: Y133N

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88002896 missense probably benign 0.02
IGL01908:Fbxo11 APN 17 87992300 missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88012651 missense probably benign 0.00
IGL02149:Fbxo11 APN 17 87993759 missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88009286 missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88011283 unclassified probably benign
IGL03265:Fbxo11 APN 17 87992831 missense probably damaging 1.00
R0184:Fbxo11 UTSW 17 88008673 missense probably benign 0.19
R0335:Fbxo11 UTSW 17 88015613 missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 87997603 missense probably damaging 1.00
R3725:Fbxo11 UTSW 17 88009286 missense probably benign 0.03
R4194:Fbxo11 UTSW 17 88009108 missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 87992333 missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88065274 unclassified probably benign
R5651:Fbxo11 UTSW 17 88015708 missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88008669 missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88008904 missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88002854 missense
R7813:Fbxo11 UTSW 17 88000817 missense
R7823:Fbxo11 UTSW 17 87993182 missense probably damaging 0.98
R7914:Fbxo11 UTSW 17 88012603 missense
R8835:Fbxo11 UTSW 17 88014446 missense
R8882:Fbxo11 UTSW 17 87997529 missense
R8883:Fbxo11 UTSW 17 87997616 missense
RF002:Fbxo11 UTSW 17 87996053 missense
X0060:Fbxo11 UTSW 17 87992306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTTAAGACAGTCTTACggggagt -3'
(R):5'- accagCACCATCTCAGAAGCCA -3'

Sequencing Primer
(F):5'- ggacagaagagggaggacac -3'
(R):5'- CAGAAGCCAGTGCATTAATTGCT -3'
Posted On2014-05-09