Incidental Mutation 'R1658:Elp2'
ID186557
Institutional Source Beutler Lab
Gene Symbol Elp2
Ensembl Gene ENSMUSG00000024271
Gene Nameelongator acetyltransferase complex subunit 2
SynonymsStatip1, StIP1, Stat3-interacting protein
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24603961-24638830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24617413 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 269 (T269M)
Ref Sequence ENSEMBL: ENSMUSP00000025120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
AA Change: T269M

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271
AA Change: T269M

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the elongator complex, a histone acetyltransferase complex that associates with RNA polymerase II. In addition to histone acetylation, the encoded protein effects transcriptional elongation and may help remodel chromatin. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Elp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Elp2 APN 18 24617491 missense probably benign 0.01
IGL01909:Elp2 APN 18 24619519 splice site probably benign
IGL01974:Elp2 APN 18 24626203 missense probably damaging 0.99
IGL02243:Elp2 APN 18 24622606 missense probably benign 0.11
IGL03049:Elp2 APN 18 24631459 missense probably benign 0.05
IGL03236:Elp2 APN 18 24622243 splice site probably benign
IGL03380:Elp2 APN 18 24622480 missense probably benign 0.05
Camelid UTSW 18 24625549 missense probably damaging 1.00
PIT4283001:Elp2 UTSW 18 24622130 missense probably damaging 1.00
PIT4531001:Elp2 UTSW 18 24604113 missense probably damaging 0.99
R0119:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0244:Elp2 UTSW 18 24631471 missense possibly damaging 0.81
R0299:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0609:Elp2 UTSW 18 24626156 missense probably benign
R0671:Elp2 UTSW 18 24612442 splice site probably benign
R1531:Elp2 UTSW 18 24631404 missense probably benign 0.06
R1673:Elp2 UTSW 18 24611926 missense possibly damaging 0.93
R2012:Elp2 UTSW 18 24631458 missense probably benign 0.00
R3861:Elp2 UTSW 18 24606920 missense probably benign 0.01
R4038:Elp2 UTSW 18 24634348 missense probably damaging 1.00
R4396:Elp2 UTSW 18 24609650 missense probably damaging 1.00
R4507:Elp2 UTSW 18 24626120 splice site probably null
R4901:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R5389:Elp2 UTSW 18 24606903 missense possibly damaging 0.87
R5511:Elp2 UTSW 18 24612450 nonsense probably null
R5633:Elp2 UTSW 18 24615210 missense probably damaging 1.00
R5728:Elp2 UTSW 18 24617452 missense probably damaging 1.00
R6585:Elp2 UTSW 18 24625549 missense probably damaging 1.00
R6855:Elp2 UTSW 18 24606877 missense possibly damaging 0.48
R6877:Elp2 UTSW 18 24634976 missense probably benign 0.00
R7145:Elp2 UTSW 18 24604069 missense probably benign 0.42
R7163:Elp2 UTSW 18 24614446 missense probably benign 0.00
R7313:Elp2 UTSW 18 24609659 missense probably benign 0.05
R7318:Elp2 UTSW 18 24606899 missense probably damaging 1.00
R7403:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R7497:Elp2 UTSW 18 24611928 missense probably damaging 0.96
R8017:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
R8019:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACACTATGGATGGAAGCCAGACTG -3'
(R):5'- GATTACACAGGTCAAGACGCCTCAC -3'

Sequencing Primer
(F):5'- agattaaacccagggcttcac -3'
(R):5'- GTCAAGACGCCTCACTTTTATGAAC -3'
Posted On2014-05-09