Incidental Mutation 'R1658:Gstp1'
ID186559
Institutional Source Beutler Lab
Gene Symbol Gstp1
Ensembl Gene ENSMUSG00000060803
Gene Nameglutathione S-transferase, pi 1
SynonymsGstpiB, Gst p-1
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4035407-4037921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4037375 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 20 (M20K)
Ref Sequence ENSEMBL: ENSMUSP00000129565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042700] [ENSMUST00000169613]
PDB Structure GLUTATHIONE S-TRANSFERASE YFYF CYS 47-CARBOXYMETHYLATED CLASS PI, FREE ENZYME [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
GLUTATHIONE S-TRANSFERASE YFYF, CLASS PI, COMPLEXED WITH GLUTATHIONE [X-RAY DIFFRACTION]
MODIFIED GLUTATHIONE S-TRANSFERASE (PI) COMPLEXED WITH S (P-NITROBENZYL)GLUTATHIONE [X-RAY DIFFRACTION]
MOLECULAR STRUCTURE AT 1.8 ANGSTROMS OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-hexyl glutathione [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-(p-nitrobenzyl) Glutathione [X-RAY DIFFRACTION]
Structure of Glutathione-S-Transferase C169A Mutant [X-RAY DIFFRACTION]
1.8 Angstroms molecular structure of mouse liver glutathione S-transferase mutant C47A complexed with S-(P-nitrobenzyl)glutathione [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042700
SMART Domains Protein: ENSMUSP00000038931
Gene: ENSMUSG00000038155

DomainStartEndE-ValueType
Pfam:GST_N 2 75 4.2e-8 PFAM
Pfam:GST_C 97 188 1.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169613
AA Change: M20K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129565
Gene: ENSMUSG00000060803
AA Change: M20K

DomainStartEndE-ValueType
Pfam:GST_N 4 75 2.3e-8 PFAM
Pfam:GST_C 97 188 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice with null mutations in both Gstp1 and Gstp2 exhibit an increased susceptibility to DMBA and TPA induced skin papillomas. Male mutant mice exhibit an increased body weight with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Gstp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1848:Gstp1 UTSW 19 4036795 splice site probably benign
R3432:Gstp1 UTSW 19 4036695 missense possibly damaging 0.50
R6634:Gstp1 UTSW 19 4035510 missense probably benign 0.21
R8755:Gstp1 UTSW 19 4036698 missense probably damaging 1.00
RF021:Gstp1 UTSW 19 4035507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACCTTGGTGATGCTGCTGC -3'
(R):5'- GTTTCAAACCAGAGAAGGGACCCG -3'

Sequencing Primer
(F):5'- ATGCTGCTGCCTCCCAG -3'
(R):5'- TACTTCCCAGTTCGAGGTAAGAC -3'
Posted On2014-05-09