Incidental Mutation 'R1658:Tmem2'
ID186560
Institutional Source Beutler Lab
Gene Symbol Tmem2
Ensembl Gene ENSMUSG00000024754
Gene Nametransmembrane protein 2
Synonyms
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location21778342-21858327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21801879 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 351 (V351A)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
Predicted Effect probably damaging
Transcript: ENSMUST00000025663
AA Change: V351A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: V351A

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096194
AA Change: V351A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: V351A

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Tmem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tmem2 APN 19 21844757 missense possibly damaging 0.77
IGL01528:Tmem2 APN 19 21835545 missense possibly damaging 0.95
IGL01642:Tmem2 APN 19 21823901 missense probably damaging 1.00
IGL01693:Tmem2 APN 19 21801887 missense probably benign 0.00
IGL02437:Tmem2 APN 19 21811978 critical splice donor site probably null
IGL02869:Tmem2 APN 19 21811877 missense probably damaging 0.99
IGL02880:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02904:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02941:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02950:Tmem2 APN 19 21842200 missense probably benign 0.07
IGL03066:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL03120:Tmem2 APN 19 21823843 missense possibly damaging 0.68
R0005:Tmem2 UTSW 19 21812220 missense probably damaging 0.98
R0496:Tmem2 UTSW 19 21797345 missense possibly damaging 0.89
R0557:Tmem2 UTSW 19 21811903 missense probably benign 0.05
R0620:Tmem2 UTSW 19 21817971 missense probably benign
R1271:Tmem2 UTSW 19 21823904 missense possibly damaging 0.92
R1435:Tmem2 UTSW 19 21844706 missense probably benign
R1543:Tmem2 UTSW 19 21812573 missense probably benign 0.03
R1558:Tmem2 UTSW 19 21797982 nonsense probably null
R1744:Tmem2 UTSW 19 21832137 nonsense probably null
R1859:Tmem2 UTSW 19 21847977 missense possibly damaging 0.56
R1943:Tmem2 UTSW 19 21848040 splice site probably null
R2001:Tmem2 UTSW 19 21801987 missense probably benign 0.43
R2021:Tmem2 UTSW 19 21844750 missense possibly damaging 0.91
R2177:Tmem2 UTSW 19 21811785 missense possibly damaging 0.80
R2183:Tmem2 UTSW 19 21823793 missense possibly damaging 0.81
R2921:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2922:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2923:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R3727:Tmem2 UTSW 19 21844711 missense probably benign
R3730:Tmem2 UTSW 19 21826117 missense probably damaging 0.97
R3790:Tmem2 UTSW 19 21807452 missense probably damaging 1.00
R3831:Tmem2 UTSW 19 21847951 missense probably damaging 0.97
R3858:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3859:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3899:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R4096:Tmem2 UTSW 19 21792652 start codon destroyed probably null 0.99
R4206:Tmem2 UTSW 19 21842115 missense probably damaging 1.00
R4480:Tmem2 UTSW 19 21815489 missense probably benign 0.03
R4667:Tmem2 UTSW 19 21797351 missense probably benign 0.00
R4667:Tmem2 UTSW 19 21844781 missense probably benign
R4888:Tmem2 UTSW 19 21856164 missense probably benign 0.00
R4914:Tmem2 UTSW 19 21809289 missense probably benign 0.00
R5030:Tmem2 UTSW 19 21842105 missense probably benign
R5329:Tmem2 UTSW 19 21798329 missense probably benign 0.30
R5977:Tmem2 UTSW 19 21826083 missense probably benign 0.01
R6013:Tmem2 UTSW 19 21832039 missense possibly damaging 0.89
R6049:Tmem2 UTSW 19 21826126 missense probably benign
R6199:Tmem2 UTSW 19 21844822 missense probably benign 0.05
R6215:Tmem2 UTSW 19 21812387 missense probably benign 0.02
R6273:Tmem2 UTSW 19 21802005 missense probably damaging 1.00
R6429:Tmem2 UTSW 19 21801908 missense probably benign 0.14
R6547:Tmem2 UTSW 19 21844831 missense probably benign 0.01
R6630:Tmem2 UTSW 19 21852229 missense probably damaging 0.99
R6870:Tmem2 UTSW 19 21832123 missense possibly damaging 0.91
R7276:Tmem2 UTSW 19 21835460 missense probably benign 0.14
R7336:Tmem2 UTSW 19 21826145 nonsense probably null
R7363:Tmem2 UTSW 19 21856211 missense probably benign
R7678:Tmem2 UTSW 19 21798116 missense probably damaging 1.00
R7727:Tmem2 UTSW 19 21829957 missense probably benign 0.00
R7820:Tmem2 UTSW 19 21807461 missense probably damaging 0.98
R7837:Tmem2 UTSW 19 21798021 missense probably benign 0.40
R7859:Tmem2 UTSW 19 21832175 missense possibly damaging 0.95
R7954:Tmem2 UTSW 19 21792900 missense probably damaging 1.00
R7964:Tmem2 UTSW 19 21798430 critical splice donor site probably null
R8058:Tmem2 UTSW 19 21852331 missense probably benign 0.12
R8251:Tmem2 UTSW 19 21807401 missense possibly damaging 0.82
R8746:Tmem2 UTSW 19 21826101 missense probably damaging 1.00
R8820:Tmem2 UTSW 19 21807454 missense probably damaging 0.99
Z1177:Tmem2 UTSW 19 21855729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCTGTGAGAAAGCTGGAAAATC -3'
(R):5'- AAACAACCTTGGCCTACCTTGACTC -3'

Sequencing Primer
(F):5'- TCAAGTTTCTGAAAGCCAGGTG -3'
(R):5'- GACTCCATTCACTGTAGGCTG -3'
Posted On2014-05-09