Incidental Mutation 'R1658:Tjp2'
ID186561
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24112947 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 577 (D577G)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000099558
AA Change: D577G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: D577G

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
PIT4402001:Tjp2 UTSW 19 24098129 nonsense probably null
R0032:Tjp2 UTSW 19 24108695 missense probably damaging 1.00
R0667:Tjp2 UTSW 19 24108749 missense probably benign 0.36
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1571:Tjp2 UTSW 19 24100875 missense probably damaging 1.00
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4077:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 splice site probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 splice site probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense probably benign 0.40
R7514:Tjp2 UTSW 19 24111522 missense probably benign 0.03
R8004:Tjp2 UTSW 19 24114120 missense probably damaging 1.00
R8505:Tjp2 UTSW 19 24111074 missense probably null 1.00
R8527:Tjp2 UTSW 19 24111573 missense probably damaging 0.99
R8710:Tjp2 UTSW 19 24095432 missense probably damaging 1.00
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Z1176:Tjp2 UTSW 19 24131365 missense probably benign 0.00
Z1177:Tjp2 UTSW 19 24095460 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CGATCCTCACGGCCAGCCA -3'
(R):5'- AGCCTCACAAGTTGCTTCACCTTTC -3'

Sequencing Primer
(F):5'- GGGGAGTTTCCTTCTCACATTCA -3'
(R):5'- ggaggaaggcagatggaag -3'
Posted On2014-05-09