Incidental Mutation 'R1659:Cd84'
ID186567
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene NameCD84 antigen
SynonymsCDw84, A130013D22Rik, SLAMF5
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1659 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171839697-171890718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171872750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000120881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000155802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042302
AA Change: T145A

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128189
Predicted Effect possibly damaging
Transcript: ENSMUST00000136479
AA Change: T145A

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155802
AA Change: T145A

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Meta Mutation Damage Score 0.2120 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171852137 critical splice donor site probably null
IGL01371:Cd84 APN 1 171886370 missense probably benign 0.36
IGL03035:Cd84 APN 1 171852034 missense probably damaging 0.99
IGL03098:Cd84 APN 1 171872700 missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171872927 missense probably benign 0.00
R1244:Cd84 UTSW 1 171851830 missense probably damaging 0.99
R1438:Cd84 UTSW 1 171852118 missense probably damaging 1.00
R1459:Cd84 UTSW 1 171851943 missense probably benign 0.02
R1654:Cd84 UTSW 1 171884606 missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171884585 splice site probably null
R1990:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2098:Cd84 UTSW 1 171885581 missense probably benign 0.07
R4674:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4806:Cd84 UTSW 1 171852121 missense probably benign 0.00
R4828:Cd84 UTSW 1 171872748 missense probably damaging 0.97
R4908:Cd84 UTSW 1 171872865 missense probably damaging 0.96
R5366:Cd84 UTSW 1 171873305 missense probably damaging 1.00
R5725:Cd84 UTSW 1 171873361 missense probably benign 0.00
R5883:Cd84 UTSW 1 171872838 missense possibly damaging 0.58
R6722:Cd84 UTSW 1 171872777 missense probably damaging 0.98
R6966:Cd84 UTSW 1 171886409 missense possibly damaging 0.93
R7513:Cd84 UTSW 1 171884618 missense probably benign 0.01
R7733:Cd84 UTSW 1 171840659 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGTATCACTACCAGCACCATGT -3'
(R):5'- ATTTCTGAGGCTTTCCAGAAGGGAAC -3'

Sequencing Primer
(F):5'- agttgctggtttcagctcac -3'
(R):5'- ACCTGTACATGGCTGCTG -3'
Posted On2014-05-09