Incidental Mutation 'R1659:Itga10'
ID186572
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1659 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96662977 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1150 (T1150A)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365]
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: T1151A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: T1151A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077278
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: T1150A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: T1150A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127607
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACTTGGAGGTGATTCAGACCCAC -3'
(R):5'- GGCTCAAAAGTCAAGTCAGGCTGC -3'

Sequencing Primer
(F):5'- GAAGGTAAGGCCAGCATCTTATTC -3'
(R):5'- TCCAAGCCTCCTTTGGATAC -3'
Posted On2014-05-09