Incidental Mutation 'R1659:Neu3'
ID 186592
Institutional Source Beutler Lab
Gene Symbol Neu3
Ensembl Gene ENSMUSG00000035239
Gene Name neuraminidase 3
Synonyms ganglioside sialidase, membrane sialidase
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1659 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 99811439-99828417 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99813433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 361 (I361T)
Ref Sequence ENSEMBL: ENSMUSP00000045222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036331]
AlphaFold Q9JMH7
Predicted Effect probably damaging
Transcript: ENSMUST00000036331
AA Change: I361T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045222
Gene: ENSMUSG00000035239
AA Change: I361T

DomainStartEndE-ValueType
Pfam:BNR_2 36 382 6.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. It is localized in the plasma membrane, and its activity is specific for gangliosides. It may play a role in modulating the ganglioside content of the lipid bilayer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased colon carcinogenesis induced by azoxymethane and dextran sodium sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Neu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Neu3 APN 7 99813880 missense probably benign 0.00
IGL01338:Neu3 APN 7 99813422 missense probably damaging 1.00
IGL01530:Neu3 APN 7 99813746 missense probably benign 0.00
R0395:Neu3 UTSW 7 99813778 missense probably benign
R0519:Neu3 UTSW 7 99823317 splice site probably benign
R0555:Neu3 UTSW 7 99814183 missense probably damaging 1.00
R1706:Neu3 UTSW 7 99823356 missense probably damaging 0.99
R1893:Neu3 UTSW 7 99823420 missense possibly damaging 0.81
R2271:Neu3 UTSW 7 99813443 missense probably benign 0.00
R2472:Neu3 UTSW 7 99813407 missense probably damaging 1.00
R4962:Neu3 UTSW 7 99823408 missense probably damaging 1.00
R5589:Neu3 UTSW 7 99823429 missense probably benign 0.01
R5932:Neu3 UTSW 7 99813318 nonsense probably null
R6307:Neu3 UTSW 7 99813722 missense probably benign
R7072:Neu3 UTSW 7 99814197 nonsense probably null
R7099:Neu3 UTSW 7 99813820 missense possibly damaging 0.51
R7582:Neu3 UTSW 7 99813967 missense probably benign 0.02
R8057:Neu3 UTSW 7 99814228 missense probably benign 0.08
R8497:Neu3 UTSW 7 99823135 splice site probably null
X0023:Neu3 UTSW 7 99813604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTCTTCACAGCTCAGGACCTC -3'
(R):5'- TGCTTTCAGAAGCCAACCCTGAAC -3'

Sequencing Primer
(F):5'- TCAGGACCTCATGGTCTGAAAAC -3'
(R):5'- AATTGGCAAAGGTGCTCCC -3'
Posted On 2014-05-09