Incidental Mutation 'R1659:Golgb1'
ID 186625
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgi autoantigen, golgin subfamily b, macrogolgin 1
Synonyms Giantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 039695-MU
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock # R1659 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36875140-36933085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36887617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 107 (I107V)
Ref Sequence ENSEMBL: ENSMUSP00000116503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812] [ENSMUST00000134616] [ENSMUST00000135406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: I107V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: I107V

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: I107V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: I107V

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134616
AA Change: I107V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243
AA Change: I107V

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135406
AA Change: I107V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243
AA Change: I107V

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153572
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
R8684:Golgb1 UTSW 16 36914402 missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36916313 missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36919744 missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36915689 missense probably benign
R8825:Golgb1 UTSW 16 36919447 missense probably benign 0.00
R8940:Golgb1 UTSW 16 36916397 missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36913616 missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36918819 nonsense probably null
R9365:Golgb1 UTSW 16 36915762 missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36919605 missense probably benign 0.41
R9620:Golgb1 UTSW 16 36919449 missense probably benign
R9691:Golgb1 UTSW 16 36898634 missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36893407 missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAACTCCAGCAGAAGGACGAAG -3'
(R):5'- TTCAGTCAAGGCCAACCACAGG -3'

Sequencing Primer
(F):5'- TGCTGAGCGATTGATAGAGACTC -3'
(R):5'- AGGCATTCTTCCCACCAGG -3'
Posted On 2014-05-09