Incidental Mutation 'R1660:Aida'
ID186638
Institutional Source Beutler Lab
Gene Symbol Aida
Ensembl Gene ENSMUSG00000042901
Gene Nameaxin interactor, dorsalization associated
Synonyms2610208M17Rik
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R1660 (G1)
Quality Score205
Status Not validated
Chromosome1
Chromosomal Location183296590-183325476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 183297583 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 22 (F22S)
Ref Sequence ENSEMBL: ENSMUSP00000141649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057062] [ENSMUST00000109166] [ENSMUST00000163528] [ENSMUST00000192829] [ENSMUST00000193625] [ENSMUST00000193959] [ENSMUST00000194327] [ENSMUST00000195054]
PDB Structure
Solution structure of four helical up-and-down bundle domain of the hypothetical protein 2610208M17Rik similar to the protein FLJ12806 [SOLUTION NMR]
Crystal Structure of the C-terminal domain of Aida [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057062
SMART Domains Protein: ENSMUSP00000061345
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
BRO1 4 384 1.74e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109166
AA Change: F22S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104795
Gene: ENSMUSG00000042901
AA Change: F22S

DomainStartEndE-ValueType
Pfam:Aida_N 9 112 1.9e-43 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 155 300 2.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163528
SMART Domains Protein: ENSMUSP00000132333
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
PDB:3ZXP|C 1 101 5e-63 PDB
Blast:BRO1 4 101 1e-67 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192252
Predicted Effect probably benign
Transcript: ENSMUST00000192829
SMART Domains Protein: ENSMUSP00000141585
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
PDB:3ZXP|C 1 91 4e-55 PDB
Blast:BRO1 4 91 9e-59 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193326
Predicted Effect probably damaging
Transcript: ENSMUST00000193625
AA Change: F22S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141649
Gene: ENSMUSG00000042901
AA Change: F22S

DomainStartEndE-ValueType
Pfam:Aida_N 8 113 2.3e-49 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 145 219 6.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193959
AA Change: F5S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194089
Predicted Effect probably benign
Transcript: ENSMUST00000194327
Predicted Effect probably benign
Transcript: ENSMUST00000195054
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Aida
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Aida APN 1 183313683 nonsense probably null
billowing UTSW 1 183322491 missense probably damaging 1.00
omentum UTSW 1 183304675 splice site probably null
R1853:Aida UTSW 1 183306445 missense probably benign
R1991:Aida UTSW 1 183313692 missense probably benign
R2103:Aida UTSW 1 183313692 missense probably benign
R2159:Aida UTSW 1 183322379 missense probably benign 0.02
R3709:Aida UTSW 1 183304675 splice site probably null
R3710:Aida UTSW 1 183304675 splice site probably null
R5425:Aida UTSW 1 183322346 missense possibly damaging 0.78
R6281:Aida UTSW 1 183322290 missense probably damaging 0.99
R6784:Aida UTSW 1 183322491 missense probably damaging 1.00
R7409:Aida UTSW 1 183318874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTTGGAGCTGCAAAGTTTGG -3'
(R):5'- AGAGAAAGATGCGAGAGCTTCCCC -3'

Sequencing Primer
(F):5'- GTGGCCTTAGCGGTTCCTC -3'
(R):5'- GTCCCTAAGCAGCCAGAG -3'
Posted On2014-05-09