Incidental Mutation 'R1660:Mttp'
ID186647
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Namemicrosomal triglyceride transfer protein
Synonyms1810043K16Rik, MTP
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138089854-138144968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138103193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 718 (V718D)
Ref Sequence ENSEMBL: ENSMUSP00000096179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
Predicted Effect probably damaging
Transcript: ENSMUST00000029805
AA Change: V703D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: V703D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098580
AA Change: V718D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: V718D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196625
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
G1patch:Mttp UTSW 3 138107238 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0543:Mttp UTSW 3 138111696 missense possibly damaging 0.75
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2336:Mttp UTSW 3 138116095 missense possibly damaging 0.81
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3774:Mttp UTSW 3 138114263 splice site probably null
R3776:Mttp UTSW 3 138114263 splice site probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7074:Mttp UTSW 3 138107273 missense possibly damaging 0.53
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
R8220:Mttp UTSW 3 138123848 missense probably benign 0.00
R8335:Mttp UTSW 3 138103212 missense possibly damaging 0.90
R8352:Mttp UTSW 3 138112613 missense probably damaging 1.00
R8452:Mttp UTSW 3 138112613 missense probably damaging 1.00
R8536:Mttp UTSW 3 138104943 missense probably damaging 1.00
R8677:Mttp UTSW 3 138104676 missense probably benign 0.00
R8877:Mttp UTSW 3 138112556 missense probably damaging 0.99
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAACATGTACACATGCGAGTGAG -3'
(R):5'- TGGGGAAAGTAACTGAGCACCACC -3'

Sequencing Primer
(F):5'- ACATGCGAGTGAGCACAC -3'
(R):5'- caaggactcaaagccccac -3'
Posted On2014-05-09