Incidental Mutation 'R1660:Zfp418'
ID186661
Institutional Source Beutler Lab
Gene Symbol Zfp418
Ensembl Gene ENSMUSG00000034538
Gene Namezinc finger protein 418
SynonymsA230102I05Rik
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location7171330-7183562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7181790 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 251 (T251A)
Ref Sequence ENSEMBL: ENSMUSP00000057159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051435]
Predicted Effect probably benign
Transcript: ENSMUST00000051435
AA Change: T251A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057159
Gene: ENSMUSG00000034538
AA Change: T251A

DomainStartEndE-ValueType
KRAB 25 78 2.58e-17 SMART
low complexity region 196 211 N/A INTRINSIC
ZnF_C2H2 256 278 6.32e-3 SMART
ZnF_C2H2 284 306 2.57e-3 SMART
ZnF_C2H2 312 334 1.56e-2 SMART
ZnF_C2H2 340 362 1.36e-2 SMART
ZnF_C2H2 368 390 1.82e-3 SMART
ZnF_C2H2 396 418 1.04e-3 SMART
ZnF_C2H2 424 446 2.75e-3 SMART
ZnF_C2H2 452 474 4.47e-3 SMART
ZnF_C2H2 480 502 1.58e-3 SMART
ZnF_C2H2 508 530 8.6e-5 SMART
ZnF_C2H2 536 558 7.78e-3 SMART
ZnF_C2H2 564 586 1.5e-4 SMART
ZnF_C2H2 592 614 4.54e-4 SMART
ZnF_C2H2 620 642 5.59e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Zfp418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Zfp418 APN 7 7181449 missense possibly damaging 0.72
IGL02351:Zfp418 APN 7 7174691 splice site probably benign
IGL02358:Zfp418 APN 7 7174691 splice site probably benign
P0029:Zfp418 UTSW 7 7174637 missense probably damaging 0.98
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R1065:Zfp418 UTSW 7 7181562 missense probably benign 0.18
R1168:Zfp418 UTSW 7 7182501 missense possibly damaging 0.91
R1937:Zfp418 UTSW 7 7182402 missense possibly damaging 0.71
R2266:Zfp418 UTSW 7 7182808 missense probably benign 0.18
R3119:Zfp418 UTSW 7 7181689 missense possibly damaging 0.53
R4355:Zfp418 UTSW 7 7172162 missense probably benign 0.02
R4539:Zfp418 UTSW 7 7181277 missense probably benign 0.18
R4735:Zfp418 UTSW 7 7182562 missense probably damaging 0.96
R4756:Zfp418 UTSW 7 7182763 missense possibly damaging 0.89
R4763:Zfp418 UTSW 7 7181445 missense possibly damaging 0.53
R4810:Zfp418 UTSW 7 7182847 missense possibly damaging 0.82
R5347:Zfp418 UTSW 7 7182535 missense probably benign 0.40
R5592:Zfp418 UTSW 7 7181315 missense possibly damaging 0.72
R5640:Zfp418 UTSW 7 7181981 nonsense probably null
R5974:Zfp418 UTSW 7 7182200 missense possibly damaging 0.95
R6209:Zfp418 UTSW 7 7182097 missense possibly damaging 0.51
R6218:Zfp418 UTSW 7 7182628 missense possibly damaging 0.73
R6502:Zfp418 UTSW 7 7182600 missense possibly damaging 0.86
R6619:Zfp418 UTSW 7 7181896 missense probably damaging 0.98
R7205:Zfp418 UTSW 7 7181563 missense probably benign 0.33
R7299:Zfp418 UTSW 7 7182828 missense possibly damaging 0.61
R7492:Zfp418 UTSW 7 7181397 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGCCATTCCCAAAGGTGAGAAAC -3'
(R):5'- GTAGCTCTCTGGCGAAAGCATAGAC -3'

Sequencing Primer
(F):5'- TTCCCAAAGGTGAGAAACAAAATC -3'
(R):5'- aacagcctcccgcagtc -3'
Posted On2014-05-09