Incidental Mutation 'R1660:Cyp2g1'
ID 186662
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 039696-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1660 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 26508352-26520622 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to A at 26509107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944] [ENSMUST00000040944] [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably null
Transcript: ENSMUST00000040944
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040944
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040944
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,870,507 (GRCm39) S3* probably null Het
Adgrv1 C T 13: 81,624,750 (GRCm39) V3740I probably benign Het
Aida T C 1: 183,079,127 (GRCm39) F22S probably damaging Het
Ankrd65 A T 4: 155,876,528 (GRCm39) D220V probably damaging Het
Antxr2 A T 5: 98,123,209 (GRCm39) C279* probably null Het
Ap3b1 T C 13: 94,545,320 (GRCm39) V191A probably damaging Het
Arhgef28 T C 13: 98,117,884 (GRCm39) K595E probably benign Het
Atp12a A G 14: 56,608,305 (GRCm39) T98A probably benign Het
Cdcp1 A T 9: 123,014,427 (GRCm39) S116T probably benign Het
Chrm1 T C 19: 8,656,582 (GRCm39) F429S possibly damaging Het
Ckap5 C A 2: 91,393,303 (GRCm39) Q395K possibly damaging Het
Cntn4 T A 6: 106,656,258 (GRCm39) I853K probably benign Het
Dhx57 C T 17: 80,553,157 (GRCm39) V1257I possibly damaging Het
Disp1 A T 1: 182,869,306 (GRCm39) V1038D probably damaging Het
Dmxl2 A T 9: 54,358,314 (GRCm39) S462T possibly damaging Het
Dnaaf10 A T 11: 17,177,183 (GRCm39) E180D probably benign Het
Exoc3l A G 8: 106,019,692 (GRCm39) probably null Het
Fam210a T C 18: 68,409,167 (GRCm39) T48A probably benign Het
Fbxw5 G A 2: 25,393,286 (GRCm39) probably null Het
Fkbp9 T C 6: 56,850,434 (GRCm39) C437R probably damaging Het
Gpc5 A G 14: 115,636,691 (GRCm39) K458R probably benign Het
Grik2 C A 10: 49,120,439 (GRCm39) G56* probably null Het
Igsf10 T C 3: 59,238,706 (GRCm39) T492A probably damaging Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Lrrc51 T C 7: 101,562,645 (GRCm39) Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Mapkbp1 A T 2: 119,849,029 (GRCm39) I682F possibly damaging Het
Mttp A T 3: 137,808,954 (GRCm39) V718D probably damaging Het
Myt1l T A 12: 29,945,272 (GRCm39) D1012E unknown Het
Nbn G A 4: 15,971,771 (GRCm39) G301D probably benign Het
Ncstn T A 1: 171,894,339 (GRCm39) S677C possibly damaging Het
Nod1 C A 6: 54,921,218 (GRCm39) probably null Het
Nos1ap A G 1: 170,342,206 (GRCm39) V52A possibly damaging Het
Or51f2 T G 7: 102,526,863 (GRCm39) Y179D probably damaging Het
Or52z14 T A 7: 103,252,882 (GRCm39) L7* probably null Het
Or5b98 T A 19: 12,931,055 (GRCm39) I34N probably damaging Het
Or5h23 T A 16: 58,906,706 (GRCm39) I47F probably benign Het
Phf13 T C 4: 152,076,962 (GRCm39) I77V probably benign Het
Pias2 A G 18: 77,207,825 (GRCm39) K230E probably damaging Het
Poli A G 18: 70,642,535 (GRCm39) L469P probably damaging Het
Prag1 A T 8: 36,607,177 (GRCm39) T973S possibly damaging Het
Prpf40b C A 15: 99,203,442 (GRCm39) H101Q probably damaging Het
Prss50 T C 9: 110,691,557 (GRCm39) V287A possibly damaging Het
Rbm25 C T 12: 83,714,924 (GRCm39) probably benign Het
Rcor2 T C 19: 7,246,337 (GRCm39) V4A probably damaging Het
Rnf180 T C 13: 105,407,499 (GRCm39) T17A probably benign Het
Robo3 A T 9: 37,340,440 (GRCm39) V179E probably damaging Het
Sacs T A 14: 61,446,458 (GRCm39) S2835T probably damaging Het
Serpinb3c T A 1: 107,199,432 (GRCm39) H363L probably damaging Het
Setd1a T C 7: 127,395,841 (GRCm39) probably benign Het
Skp2 A C 15: 9,125,201 (GRCm39) V126G probably benign Het
Snph G A 2: 151,436,398 (GRCm39) Q108* probably null Het
Snrpa1 T A 7: 65,719,246 (GRCm39) V144E probably damaging Het
Tifab T C 13: 56,324,248 (GRCm39) E65G probably damaging Het
Tmem201 A T 4: 149,804,032 (GRCm39) Y468N probably damaging Het
Tpcn1 T C 5: 120,687,580 (GRCm39) N388S possibly damaging Het
Tssk4 A G 14: 55,888,029 (GRCm39) Q75R probably null Het
Tuba4a T C 1: 75,192,547 (GRCm39) N356D probably benign Het
Ugt2b5 T A 5: 87,287,477 (GRCm39) D230V probably benign Het
Ush2a T C 1: 188,648,261 (GRCm39) V4622A probably benign Het
Vmn2r11 T G 5: 109,201,724 (GRCm39) Y260S possibly damaging Het
Vmn2r89 C A 14: 51,693,693 (GRCm39) H348N possibly damaging Het
Vmn2r96 A T 17: 18,817,988 (GRCm39) M714L probably benign Het
Zbtb18 T C 1: 177,275,329 (GRCm39) S221P probably benign Het
Zfp418 A G 7: 7,184,789 (GRCm39) T251A probably benign Het
Zmynd15 A G 11: 70,354,328 (GRCm39) Y267C probably damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26,509,256 (GRCm39) missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26,513,684 (GRCm39) missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26,513,719 (GRCm39) splice site probably benign
IGL02338:Cyp2g1 APN 7 26,514,229 (GRCm39) splice site probably benign
IGL02452:Cyp2g1 APN 7 26,510,871 (GRCm39) missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26,518,612 (GRCm39) missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26,509,201 (GRCm39) missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26,518,828 (GRCm39) missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26,513,619 (GRCm39) missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26,513,720 (GRCm39) splice site probably benign
R0697:Cyp2g1 UTSW 7 26,514,152 (GRCm39) nonsense probably null
R0830:Cyp2g1 UTSW 7 26,514,216 (GRCm39) missense probably benign 0.00
R2093:Cyp2g1 UTSW 7 26,518,858 (GRCm39) missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26,520,135 (GRCm39) missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26,513,579 (GRCm39) missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26,520,226 (GRCm39) missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26,520,165 (GRCm39) missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26,516,065 (GRCm39) missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26,513,604 (GRCm39) missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26,520,184 (GRCm39) missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26,514,057 (GRCm39) missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26,518,618 (GRCm39) missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26,518,886 (GRCm39) missense probably benign
R8177:Cyp2g1 UTSW 7 26,518,578 (GRCm39) missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26,514,159 (GRCm39) missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26,509,256 (GRCm39) missense probably benign 0.05
R9406:Cyp2g1 UTSW 7 26,518,910 (GRCm39) critical splice donor site probably null
R9441:Cyp2g1 UTSW 7 26,514,060 (GRCm39) missense possibly damaging 0.72
X0067:Cyp2g1 UTSW 7 26,520,187 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGAAGGTCACAGATGGCACAGC -3'
(R):5'- AGAGACCCTTGAACACACTGAGTCC -3'

Sequencing Primer
(F):5'- cagagttcagctagtctgacc -3'
(R):5'- TGTTATTGATGCTACTTACCATAACC -3'
Posted On 2014-05-09