Incidental Mutation 'R1660:Lrrc51'
ID186665
Institutional Source Beutler Lab
Gene Symbol Lrrc51
Ensembl Gene ENSMUSG00000064307
Gene Nameleucine rich repeat containing 51
SynonymsLrtomt
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101912984-101933895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101913438 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 145 (Y145C)
Ref Sequence ENSEMBL: ENSMUSP00000129333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033131] [ENSMUST00000078448] [ENSMUST00000098236] [ENSMUST00000106963] [ENSMUST00000106964] [ENSMUST00000106965] [ENSMUST00000106966] [ENSMUST00000106967] [ENSMUST00000106968] [ENSMUST00000163903] [ENSMUST00000193465]
Predicted Effect probably benign
Transcript: ENSMUST00000033131
SMART Domains Protein: ENSMUSP00000033131
Gene: ENSMUSG00000030842

DomainStartEndE-ValueType
LAMTOR 15 90 1.48e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078448
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077543
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_9 86 188 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098236
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095838
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 1.5e-9 PFAM
Pfam:LRR_7 102 118 8.7e-2 PFAM
Pfam:LRR_7 127 141 1e-1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106963
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102576
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 1.5e-9 PFAM
Pfam:LRR_7 102 118 8.7e-2 PFAM
Pfam:LRR_7 127 141 1e-1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106964
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102577
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 1.5e-9 PFAM
Pfam:LRR_7 102 118 8.7e-2 PFAM
Pfam:LRR_7 127 141 1e-1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106965
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102578
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 6.5e-10 PFAM
Pfam:LRR_7 102 118 3.3e-2 PFAM
Pfam:LRR_7 127 142 3.7e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106966
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102579
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 2.1e-9 PFAM
Pfam:LRR_9 84 187 3e-11 PFAM
Pfam:LRR_7 102 118 1e-1 PFAM
Pfam:LRR_7 127 143 1.1e-1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106967
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102580
Gene: ENSMUSG00000064307
AA Change: Y112C

DomainStartEndE-ValueType
Pfam:LRR_9 40 155 7.2e-12 PFAM
Pfam:LRR_8 46 106 5.2e-10 PFAM
Pfam:LRR_7 69 85 2.9e-2 PFAM
Pfam:LRR_7 94 110 3.1e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106968
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102581
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 2.1e-9 PFAM
Pfam:LRR_9 84 187 3e-11 PFAM
Pfam:LRR_7 102 118 1e-1 PFAM
Pfam:LRR_7 127 143 1.1e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130155
Predicted Effect probably damaging
Transcript: ENSMUST00000163903
AA Change: Y145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129333
Gene: ENSMUSG00000064307
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:LRR_8 79 139 1.5e-9 PFAM
Pfam:LRR_7 102 118 8.7e-2 PFAM
Pfam:LRR_7 127 141 1e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193465
SMART Domains Protein: ENSMUSP00000141774
Gene: ENSMUSG00000030842

DomainStartEndE-ValueType
LAMTOR 15 90 1.1e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211180
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Lrrc51
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1518:Lrrc51 UTSW 7 101915596 missense probably damaging 1.00
R7527:Lrrc51 UTSW 7 101920636 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCACATACTGCCTGTGAGGAAG -3'
(R):5'- CTGAGATCCAGTCTTTGTCCAGCC -3'

Sequencing Primer
(F):5'- ATACTGCCTGTGAGGAAGACTTG -3'
(R):5'- CTGACTTTTGATTTCTACCCTAACAG -3'
Posted On2014-05-09