Incidental Mutation 'R1660:Cdcp1'
ID186675
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene NameCUB domain containing protein 1
Synonyms
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123170824-123216038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123185362 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 116 (S116T)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
Predicted Effect probably benign
Transcript: ENSMUST00000039229
AA Change: S116T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: S116T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123180001 nonsense probably null
IGL01883:Cdcp1 APN 9 123183598 missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123183834 splice site probably benign
IGL02115:Cdcp1 APN 9 123185397 missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123173637 missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123173814 missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123180087 missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123185313 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123183690 missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123190112 missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123180027 missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123173588 missense probably damaging 1.00
R1673:Cdcp1 UTSW 9 123178021 nonsense probably null
R1794:Cdcp1 UTSW 9 123190094 missense probably benign 0.37
R1794:Cdcp1 UTSW 9 123215831 missense probably benign
R2472:Cdcp1 UTSW 9 123185107 missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123183628 missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123182129 intron probably benign
R4953:Cdcp1 UTSW 9 123180023 missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123185193 missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123178029 missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123183705 missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123173772 nonsense probably null
R6052:Cdcp1 UTSW 9 123185331 missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123182382 missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123173915 missense probably benign
R7038:Cdcp1 UTSW 9 123173597 missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123183613 missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123173615 missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123185054 missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123177921 missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123177900 missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123173813 missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123185107 missense probably benign 0.26
R7680:Cdcp1 UTSW 9 123183519 missense probably damaging 1.00
X0028:Cdcp1 UTSW 9 123185184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATTCTGACCTCAGTGGCATC -3'
(R):5'- CAGTCTGAGTATGCAGCCCAGAATG -3'

Sequencing Primer
(F):5'- AACTGCAGCTCCAAGCCAAT -3'
(R):5'- CTTAGGCTTCTCTCATCCAAAATAAC -3'
Posted On2014-05-09