Incidental Mutation 'R1660:Ap3b1'
ID 186688
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission 039696-MU
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;
Essential gene? Possibly non essential (E-score: 0.441) question?
Stock # R1660 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94408812 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 191 (V191A)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably damaging
Transcript: ENSMUST00000022196
AA Change: V191A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: V191A

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451086 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94472931 critical splice donor site probably null
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCAGAACACCTCAGCTCTCTTGAA -3'
(R):5'- CGTTACCTTGCCGATGCACACAC -3'

Sequencing Primer
(F):5'- GCTCTCTTGAAGTTACAATACATGGG -3'
(R):5'- acctcctgcctctctctc -3'
Posted On 2014-05-09