Incidental Mutation 'R1660:Arhgef28'
ID186689
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97981376 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 595 (K595E)
Ref Sequence ENSEMBL: ENSMUSP00000153000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]
Predicted Effect probably benign
Transcript: ENSMUST00000109426
AA Change: K595E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: K595E

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223849
AA Change: K595E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
AA Change: K595E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7491:Arhgef28 UTSW 13 97944686 missense probably benign 0.03
R7500:Arhgef28 UTSW 13 97978495 missense probably benign 0.00
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
R7813:Arhgef28 UTSW 13 97945681 missense possibly damaging 0.48
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTACCCCTGAGGATGGAAAAC -3'
(R):5'- AAGTCATTGAGCTGACCTCTCCCC -3'

Sequencing Primer
(F):5'- CCTGAGGATGGAAAACAGTCATTTG -3'
(R):5'- ctccccctcccccactc -3'
Posted On2014-05-09