Mutagenetix > Incidental Mutations

Incidental Mutation 'R1661:Rgl1'

186713

Institutional Source

Beutler Lab

Gene Symbol

Rgl1

Ensembl Gene

ENSMUSG00000026482

Gene Name

ral guanine nucleotide dissociation stimulator,-like 1

Synonyms

Rgl

MMRRC Submission

039697-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.360) question?

Stock #

R1661 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152516760-152766351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 152533575 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 503 (Y503C)

Ref Sequence

ENSEMBL: ENSMUSP00000107490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027760
AA Change: Y468C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: Y468C

Domain	Start	End	E-Value	Type
RasGEFN	64	196	5.86e-39	SMART
RasGEF	228	502	9.56e-116	SMART
Blast:RasGEF	522	582	6e-8	BLAST
low complexity region	585	596	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
RA	648	735	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111857
AA Change: Y466C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: Y466C

Domain	Start	End	E-Value	Type
RasGEFN	62	194	5.86e-39	SMART
RasGEF	226	500	9.56e-116	SMART
Blast:RasGEF	520	580	7e-8	BLAST
low complexity region	583	594	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
RA	646	733	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111859
AA Change: Y503C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: Y503C

Domain	Start	End	E-Value	Type
RasGEFN	99	231	5.86e-39	SMART
RasGEF	263	537	9.56e-116	SMART
Blast:RasGEF	557	617	6e-8	BLAST
low complexity region	620	631	N/A	INTRINSIC
low complexity region	662	672	N/A	INTRINSIC
RA	683	770	1.7e-25	SMART

Meta Mutation Damage Score

0.6193

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Cog2	T	C	8: 124,542,890	F390L	probably benign	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fnip2	A	G	3: 79,515,149	F108S	probably benign	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Kpna6	T	A	4: 129,657,471	R80S	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Med13l	T	A	5: 118,749,748	W1696R	probably damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Slitrk1	A	T	14: 108,911,927	Y451N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Rgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Rgl1	APN	1	152571617	missense	probably benign	0.02
IGL01065:Rgl1	APN	1	152519142	missense	probably damaging	1.00
IGL01390:Rgl1	APN	1	152571588	splice site	probably benign
IGL01726:Rgl1	APN	1	152519153	missense	probably damaging	1.00
IGL01837:Rgl1	APN	1	152549150	missense	probably damaging	1.00
IGL02019:Rgl1	APN	1	152528469	splice site	probably benign
IGL02369:Rgl1	APN	1	152533606	missense	probably damaging	1.00
R0240:Rgl1	UTSW	1	152554424	unclassified	probably benign
R0255:Rgl1	UTSW	1	152552596	missense	probably damaging	1.00
R0562:Rgl1	UTSW	1	152539945	missense	probably damaging	1.00
R0648:Rgl1	UTSW	1	152536265	critical splice donor site	probably null
R0734:Rgl1	UTSW	1	152554300	missense	probably damaging	0.98
R1187:Rgl1	UTSW	1	152544433	missense	probably benign	0.14
R1522:Rgl1	UTSW	1	152586533	missense	probably damaging	1.00
R1595:Rgl1	UTSW	1	152675023	splice site	probably benign
R1634:Rgl1	UTSW	1	152524772	missense	probably damaging	1.00
R1665:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1964:Rgl1	UTSW	1	152549104	missense	probably damaging	1.00
R2291:Rgl1	UTSW	1	152536281	missense	probably damaging	1.00
R4272:Rgl1	UTSW	1	152536289	missense	probably benign	0.13
R4668:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4669:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4747:Rgl1	UTSW	1	152524699	nonsense	probably null
R4830:Rgl1	UTSW	1	152554330	missense	probably benign	0.11
R4853:Rgl1	UTSW	1	152557574	missense	probably benign	0.07
R4969:Rgl1	UTSW	1	152549062	splice site	probably null
R5778:Rgl1	UTSW	1	152552421	missense	probably benign	0.05
R5979:Rgl1	UTSW	1	152557493	missense	probably damaging	1.00
R6180:Rgl1	UTSW	1	152519172	missense	probably damaging	1.00
R6183:Rgl1	UTSW	1	152586570	missense	possibly damaging	0.94
R6322:Rgl1	UTSW	1	152552435	missense	probably damaging	0.98
R6678:Rgl1	UTSW	1	152524724	missense	probably damaging	1.00
R6759:Rgl1	UTSW	1	152533530	missense	probably damaging	0.99
R6892:Rgl1	UTSW	1	152539940	missense	probably benign	0.00
R7290:Rgl1	UTSW	1	152544395	missense	possibly damaging	0.78
R7363:Rgl1	UTSW	1	152519163	missense	probably damaging	1.00
R7610:Rgl1	UTSW	1	152552620	missense	probably damaging	1.00
R7774:Rgl1	UTSW	1	152554350	missense	probably benign
R8140:Rgl1	UTSW	1	152557501	missense	probably damaging	1.00
RF005:Rgl1	UTSW	1	152521363	missense	probably benign
Z1088:Rgl1	UTSW	1	152675020	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGAAATCTCCCTTCACAGCCCAG -3'
(R):5'- AGGCAGCCAGATTGCAGAGTCTTC -3'

Sequencing Primer
(F):5'- GAGCATGGCTACTATTCTAATAGGGC -3'
(R):5'- GCAGAGTCTTCTTCAATGGC -3'

Posted On

2014-05-09