Incidental Mutation 'R1661:Mfn1'
ID186723
Institutional Source Beutler Lab
Gene Symbol Mfn1
Ensembl Gene ENSMUSG00000027668
Gene Namemitofusin 1
Synonyms6330416C07Rik, HR2, D3Ertd265e, 2310002F04Rik
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32529465-32579239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32534322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 66 (V66G)
Ref Sequence ENSEMBL: ENSMUSP00000117411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091257] [ENSMUST00000118286] [ENSMUST00000137565] [ENSMUST00000147350]
Predicted Effect probably benign
Transcript: ENSMUST00000091257
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088801
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.7e-6 PFAM
Pfam:Dynamin_N 78 238 3.9e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 575 735 1.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118286
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113251
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.2e-6 PFAM
Pfam:Dynamin_N 78 238 5e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 567 737 6.3e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125182
Predicted Effect probably benign
Transcript: ENSMUST00000137565
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117411
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 188 3.8e-6 PFAM
Pfam:Dynamin_N 78 189 5.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147350
AA Change: V66G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116380
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 3.6e-8 PFAM
Pfam:Dynamin_N 78 238 1.5e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Adamts9 G T 6: 92,880,623 Q895K possibly damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Smc3 A G 19: 53,625,065 D403G probably benign Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Mfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mfn1 APN 3 32542836 missense probably damaging 1.00
IGL01687:Mfn1 APN 3 32563366 splice site probably benign
IGL02743:Mfn1 APN 3 32574290 missense probably benign 0.10
PIT4520001:Mfn1 UTSW 3 32561546 missense probably benign
R0039:Mfn1 UTSW 3 32538267 splice site probably benign
R0571:Mfn1 UTSW 3 32561472 missense probably damaging 1.00
R0920:Mfn1 UTSW 3 32534236 critical splice acceptor site probably null
R1665:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R2153:Mfn1 UTSW 3 32542826 missense probably damaging 1.00
R2156:Mfn1 UTSW 3 32534251 missense possibly damaging 0.60
R2260:Mfn1 UTSW 3 32563426 nonsense probably null
R2420:Mfn1 UTSW 3 32569515 missense probably benign 0.21
R3864:Mfn1 UTSW 3 32563092 missense possibly damaging 0.89
R4079:Mfn1 UTSW 3 32542849 missense probably damaging 1.00
R4162:Mfn1 UTSW 3 32562998 splice site probably benign
R4897:Mfn1 UTSW 3 32546562 intron probably benign
R5115:Mfn1 UTSW 3 32564307 critical splice donor site probably null
R5276:Mfn1 UTSW 3 32564205 missense probably benign 0.39
R5590:Mfn1 UTSW 3 32563847 missense probably benign 0.00
R5629:Mfn1 UTSW 3 32561510 missense possibly damaging 0.83
R6110:Mfn1 UTSW 3 32563024 missense probably benign 0.01
R6114:Mfn1 UTSW 3 32563836 missense probably damaging 1.00
R6560:Mfn1 UTSW 3 32569516 missense probably damaging 0.96
R6891:Mfn1 UTSW 3 32577103 missense possibly damaging 0.49
R7053:Mfn1 UTSW 3 32531965 missense probably benign 0.00
R7071:Mfn1 UTSW 3 32568395 missense probably benign 0.00
R7182:Mfn1 UTSW 3 32564220 missense probably damaging 1.00
R8190:Mfn1 UTSW 3 32568389 missense possibly damaging 0.88
Z1177:Mfn1 UTSW 3 32564291 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGGATAATCCTTTCAGAGGGC -3'
(R):5'- CTTGACCAGGCAGTAGTGACACAG -3'

Sequencing Primer
(F):5'- GGATAATCCTTTCAGAGGGCATTTAC -3'
(R):5'- gaaggaaggaaggaaggaagg -3'
Posted On2014-05-09