Mutagenetix > Incidental Mutation

Incidental Mutation 'R1661:Fnip2'

186725

Institutional Source

Beutler Lab

Gene Symbol

Fnip2

Ensembl Gene

ENSMUSG00000061175

Gene Name

folliculin interacting protein 2

Synonyms

D630023B12Rik

MMRRC Submission

039697-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1661 (G1)

Quality Score

205

Status

Not validated

Chromosome

Chromosomal Location

79455974-79567796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79515149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 108 (F108S)

Ref Sequence

ENSEMBL: ENSMUSP00000115275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]

AlphaFold

Q80TD3

Predicted Effect

probably benign
Transcript: ENSMUST00000076136
AA Change: F108S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: F108S

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	168	4.3e-39	PFAM
low complexity region	240	261	N/A	INTRINSIC
Pfam:FNIP_M	289	528	5.9e-92	PFAM
low complexity region	557	571	N/A	INTRINSIC
low complexity region	748	755	N/A	INTRINSIC
Pfam:FNIP_C	920	1104	4.1e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130613

Predicted Effect

probably benign
Transcript: ENSMUST00000133154
AA Change: F108S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: F108S

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	164	5.2e-34	PFAM
low complexity region	270	291	N/A	INTRINSIC
Pfam:FNIP_M	323	557	3.9e-93	PFAM
low complexity region	587	601	N/A	INTRINSIC
low complexity region	778	785	N/A	INTRINSIC
Pfam:FNIP_C	951	1134	2.3e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139171

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Cog2	T	C	8: 124,542,890	F390L	probably benign	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Kpna6	T	A	4: 129,657,471	R80S	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Med13l	T	A	5: 118,749,748	W1696R	probably damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Rgl1	T	C	1: 152,533,575	Y503C	probably damaging	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Slitrk1	A	T	14: 108,911,927	Y451N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Fnip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Fnip2	APN	3	79481521	missense	probably benign
IGL00339:Fnip2	APN	3	79515155	missense	probably benign	0.12
IGL00340:Fnip2	APN	3	79518061	splice site	probably benign
IGL00434:Fnip2	APN	3	79512489	splice site	probably benign
IGL01134:Fnip2	APN	3	79512503	nonsense	probably null
IGL02732:Fnip2	APN	3	79465697	missense	probably damaging	1.00
IGL03327:Fnip2	APN	3	79518081	missense	probably damaging	0.98
IGL03402:Fnip2	APN	3	79481276	missense	possibly damaging	0.92
R0314:Fnip2	UTSW	3	79481189	missense	probably damaging	1.00
R0318:Fnip2	UTSW	3	79512378	missense	probably damaging	1.00
R0699:Fnip2	UTSW	3	79481139	missense	probably benign	0.00
R1188:Fnip2	UTSW	3	79462162	missense	probably damaging	1.00
R1290:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1535:Fnip2	UTSW	3	79481765	missense	probably damaging	1.00
R1618:Fnip2	UTSW	3	79508168	missense	possibly damaging	0.70
R1665:Fnip2	UTSW	3	79515149	missense	probably benign
R1965:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1966:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1976:Fnip2	UTSW	3	79480931	missense	probably benign	0.02
R2004:Fnip2	UTSW	3	79512325	splice site	probably benign
R2054:Fnip2	UTSW	3	79572465	unclassified	probably benign
R2145:Fnip2	UTSW	3	79500432	missense	probably damaging	0.99
R2400:Fnip2	UTSW	3	79479634	missense	probably benign	0.03
R2679:Fnip2	UTSW	3	79480926	missense	probably benign	0.13
R3157:Fnip2	UTSW	3	79567594	missense	probably damaging	1.00
R3851:Fnip2	UTSW	3	79462157	missense	probably damaging	1.00
R3910:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3911:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3912:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R4035:Fnip2	UTSW	3	79479501	missense	probably benign	0.00
R4166:Fnip2	UTSW	3	79462135	missense	probably damaging	1.00
R4537:Fnip2	UTSW	3	79465714	missense	probably damaging	0.98
R4732:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4733:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4774:Fnip2	UTSW	3	79465721	nonsense	probably null
R4923:Fnip2	UTSW	3	79489394	critical splice acceptor site	probably null
R5043:Fnip2	UTSW	3	79492867	nonsense	probably null
R5160:Fnip2	UTSW	3	79488991	missense	probably damaging	1.00
R5162:Fnip2	UTSW	3	79481777	missense	probably damaging	1.00
R5196:Fnip2	UTSW	3	79572538	unclassified	probably benign
R5283:Fnip2	UTSW	3	79465708	missense	probably damaging	1.00
R5364:Fnip2	UTSW	3	79481168	missense	probably benign	0.00
R5402:Fnip2	UTSW	3	79480943	missense	possibly damaging	0.89
R6340:Fnip2	UTSW	3	79507845	missense	probably damaging	1.00
R6459:Fnip2	UTSW	3	79481634	missense	possibly damaging	0.93
R6592:Fnip2	UTSW	3	79481708	missense	probably benign	0.26
R6616:Fnip2	UTSW	3	79480882	missense	probably benign	0.00
R6933:Fnip2	UTSW	3	79518111	missense	probably benign	0.28
R6962:Fnip2	UTSW	3	79489303	missense	probably damaging	1.00
R6971:Fnip2	UTSW	3	79481121	nonsense	probably null
R7050:Fnip2	UTSW	3	79506270	missense	probably damaging	0.99
R7097:Fnip2	UTSW	3	79481006	missense	probably benign
R7315:Fnip2	UTSW	3	79506205	critical splice donor site	probably null
R7714:Fnip2	UTSW	3	79518114	missense	probably damaging	1.00
R7782:Fnip2	UTSW	3	79508123	missense	probably benign	0.00
R8381:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R8479:Fnip2	UTSW	3	79512555	missense	probably damaging	1.00
R8485:Fnip2	UTSW	3	79481537	missense	probably benign	0.35
R9344:Fnip2	UTSW	3	79500410	missense	possibly damaging	0.87
R9753:Fnip2	UTSW	3	79508104	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TGGCTGCTGGTATAATCTCCCTGAC -3'
(R):5'- AGCCTGGTACAGTACATGATCCCTG -3'

Sequencing Primer
(F):5'- gcacatacctataatcccagcac -3'
(R):5'- GTACAGTACATGATCCCTGACCTTG -3'

Posted On

2014-05-09