Incidental Mutation 'R1661:Kpna6'
ID186729
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129657471 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 80 (R80S)
Ref Sequence ENSEMBL: ENSMUSP00000114265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590] [ENSMUST00000126010]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
AA Change: R80S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: R80S

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
AA Change: R83S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: R83S

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126010
AA Change: R80S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114265
Gene: ENSMUSG00000003731
AA Change: R80S

DomainStartEndE-ValueType
Pfam:IBB 2 88 3.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146361
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Adamts9 G T 6: 92,880,623 Q895K possibly damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Smc3 A G 19: 53,625,065 D403G probably benign Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0305:Kpna6 UTSW 4 129649249 missense probably benign 0.00
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0623:Kpna6 UTSW 4 129655416 unclassified probably benign
R0646:Kpna6 UTSW 4 129650790 missense probably benign 0.43
R1067:Kpna6 UTSW 4 129648103 missense probably benign 0.39
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCAAGGTAGGATGAGCAAT -3'
(R):5'- GAAGTCAGATGGGAAGCTCTTCTGTG -3'

Sequencing Primer
(F):5'- tggggggagggtataggg -3'
(R):5'- TTCTGTGGACAATCCACCAG -3'
Posted On2014-05-09