Mutagenetix > Incidental Mutations

Incidental Mutation 'R1661:Kpna6'

186729

Institutional Source

Beutler Lab

Gene Symbol

Kpna6

Ensembl Gene

ENSMUSG00000003731

Gene Name

karyopherin (importin) alpha 6

Synonyms

IPOA7, NPI-2

MMRRC Submission

039697-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1661 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129643980-129672767 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129657471 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 80 (R80S)

Ref Sequence

ENSEMBL: ENSMUSP00000114265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590] [ENSMUST00000126010]

Predicted Effect

probably benign
Transcript: ENSMUST00000003828
AA Change: R80S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: R80S

Domain	Start	End	E-Value	Type
Pfam:IBB	2	100	9.5e-28	PFAM
ARM	109	151	2.46e-4	SMART
ARM	153	193	6.73e-11	SMART
ARM	195	236	3.19e-3	SMART
ARM	239	278	6.64e-1	SMART
ARM	280	320	1.16e-5	SMART
ARM	322	362	1.98e-8	SMART
ARM	364	404	6.68e-6	SMART
ARM	407	447	1.89e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102590
AA Change: R83S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: R83S

Domain	Start	End	E-Value	Type
Pfam:IBB	9	102	4.4e-27	PFAM
ARM	112	154	2.46e-4	SMART
ARM	156	196	6.73e-11	SMART
ARM	198	239	3.19e-3	SMART
ARM	242	281	6.64e-1	SMART
ARM	283	323	1.16e-5	SMART
ARM	325	365	1.98e-8	SMART
ARM	367	407	6.68e-6	SMART
ARM	410	450	1.89e-5	SMART
Pfam:Arm_3	464	514	5.3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126010
AA Change: R80S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000114265
Gene: ENSMUSG00000003731
AA Change: R80S

Domain	Start	End	E-Value	Type
Pfam:IBB	2	88	3.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138916

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146361

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Cog2	T	C	8: 124,542,890	F390L	probably benign	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fnip2	A	G	3: 79,515,149	F108S	probably benign	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Med13l	T	A	5: 118,749,748	W1696R	probably damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Rgl1	T	C	1: 152,533,575	Y503C	probably damaging	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Slitrk1	A	T	14: 108,911,927	Y451N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Kpna6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Kpna6	APN	4	129655483	missense	probably damaging	1.00
IGL02750:Kpna6	APN	4	129661377	missense	probably damaging	1.00
IGL02904:Kpna6	APN	4	129650687	missense	probably benign	0.24
IGL02998:Kpna6	APN	4	129655504	missense	probably benign	0.00
IGL03370:Kpna6	APN	4	129655521	missense	probably damaging	1.00
krazy_eight	UTSW	4	129655428	critical splice donor site	probably null
magnificent_seven	UTSW	4	129649306	nonsense	probably null
R0054:Kpna6	UTSW	4	129657458	missense	probably benign	0.01
R0054:Kpna6	UTSW	4	129657458	missense	probably benign	0.01
R0305:Kpna6	UTSW	4	129649249	missense	probably benign	0.00
R0390:Kpna6	UTSW	4	129657804	missense	possibly damaging	0.61
R0623:Kpna6	UTSW	4	129655416	unclassified	probably benign
R0646:Kpna6	UTSW	4	129650790	missense	probably benign	0.43
R1067:Kpna6	UTSW	4	129648103	missense	probably benign	0.39
R1348:Kpna6	UTSW	4	129661359	nonsense	probably null
R1665:Kpna6	UTSW	4	129657471	missense	probably benign	0.10
R1766:Kpna6	UTSW	4	129657442	missense	probably benign	0.33
R4833:Kpna6	UTSW	4	129657779	missense	possibly damaging	0.51
R4941:Kpna6	UTSW	4	129648032	missense	probably damaging	1.00
R4974:Kpna6	UTSW	4	129656405	splice site	probably null
R5244:Kpna6	UTSW	4	129655428	critical splice donor site	probably null
R5914:Kpna6	UTSW	4	129672692	unclassified	probably benign
R6148:Kpna6	UTSW	4	129649306	nonsense	probably null
R6713:Kpna6	UTSW	4	129653984	missense	probably damaging	1.00
R6799:Kpna6	UTSW	4	129657454	missense	probably damaging	0.99
R6942:Kpna6	UTSW	4	129651721	splice site	probably null
R7073:Kpna6	UTSW	4	129654346	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGCAAGGTAGGATGAGCAAT -3'
(R):5'- GAAGTCAGATGGGAAGCTCTTCTGTG -3'

Sequencing Primer
(F):5'- tggggggagggtataggg -3'
(R):5'- TTCTGTGGACAATCCACCAG -3'

Posted On

2014-05-09