Incidental Mutation 'R1661:Fras1'
ID 186732
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene Name Fraser extracellular matrix complex subunit 1
Synonyms bl, E130113P14Rik
MMRRC Submission 039697-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1661 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 96521814-96932587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96746768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 613 (S613C)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036019
AA Change: S613C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: S613C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Meta Mutation Damage Score 0.2393 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,596,816 (GRCm39) G423E probably damaging Het
Acox3 A T 5: 35,760,371 (GRCm39) H429L probably damaging Het
Adamts9 G T 6: 92,857,604 (GRCm39) Q895K possibly damaging Het
Ajm1 T C 2: 25,469,167 (GRCm39) D248G possibly damaging Het
Amotl2 T A 9: 102,607,295 (GRCm39) I701N probably damaging Het
Angel2 T C 1: 190,669,664 (GRCm39) Y115H probably damaging Het
Appbp2 T C 11: 85,100,936 (GRCm39) probably null Het
Arhgap33 A C 7: 30,231,748 (GRCm39) C113W probably damaging Het
Asprv1 A G 6: 86,605,718 (GRCm39) N188S probably damaging Het
Atp8a2 T C 14: 60,097,635 (GRCm39) I798V possibly damaging Het
Caml C A 13: 55,779,784 (GRCm39) L286I probably benign Het
Ccdc125 A G 13: 100,830,081 (GRCm39) I284V probably benign Het
Cep89 A G 7: 35,117,105 (GRCm39) T236A possibly damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Cog2 T C 8: 125,269,629 (GRCm39) F390L probably benign Het
Creg2 C T 1: 39,662,372 (GRCm39) W253* probably null Het
Cttnbp2 A T 6: 18,434,982 (GRCm39) I292K probably benign Het
Ddb1 A T 19: 10,606,444 (GRCm39) Y1114F probably benign Het
Dnah6 T C 6: 73,101,761 (GRCm39) E1921G probably benign Het
Dync1h1 T C 12: 110,622,791 (GRCm39) F3494L probably damaging Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Fam222b A G 11: 78,045,987 (GRCm39) Y388C probably damaging Het
Fam227a G A 15: 79,504,878 (GRCm39) probably null Het
Fbxo32 A C 15: 58,054,865 (GRCm39) V156G probably damaging Het
Fem1b C T 9: 62,704,556 (GRCm39) V235I probably damaging Het
Fnip2 A G 3: 79,422,456 (GRCm39) F108S probably benign Het
Garin1a G C 6: 29,285,937 (GRCm39) R132P probably damaging Het
Gm7276 C A 18: 77,273,266 (GRCm39) probably benign Het
Gnb4 A C 3: 32,644,188 (GRCm39) L152* probably null Het
Hsd17b4 G A 18: 50,293,282 (GRCm39) E274K probably benign Het
Htr4 T C 18: 62,545,305 (GRCm39) I30T probably damaging Het
Ighmbp2 A G 19: 3,317,246 (GRCm39) L542P probably damaging Het
Ikzf2 T A 1: 69,577,973 (GRCm39) Y512F probably damaging Het
Itpr1 A G 6: 108,459,858 (GRCm39) N2051D probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klhl22 C A 16: 17,594,352 (GRCm39) D160E probably benign Het
Kpna6 T A 4: 129,551,264 (GRCm39) R80S probably benign Het
Lclat1 A G 17: 73,494,999 (GRCm39) E142G probably damaging Het
Lrig3 T C 10: 125,833,570 (GRCm39) Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map1b T A 13: 99,568,437 (GRCm39) N1428I unknown Het
Map3k19 T A 1: 127,745,393 (GRCm39) T1354S possibly damaging Het
Med13l T A 5: 118,887,813 (GRCm39) W1696R probably damaging Het
Megf8 A G 7: 25,063,272 (GRCm39) T2543A probably damaging Het
Mfn1 T G 3: 32,588,471 (GRCm39) V66G probably benign Het
Muc15 C T 2: 110,564,243 (GRCm39) Q260* probably null Het
Nfkb1 T C 3: 135,300,718 (GRCm39) H616R probably damaging Het
Nnmt A G 9: 48,516,174 (GRCm39) S29P probably benign Het
Nrde2 A T 12: 100,116,119 (GRCm39) S122T probably benign Het
Or10a2 T C 7: 106,673,481 (GRCm39) S149P probably damaging Het
Or4g16 T C 2: 111,137,116 (GRCm39) C189R probably damaging Het
Or7g33 C T 9: 19,448,624 (GRCm39) V201I probably benign Het
Pced1b A G 15: 97,282,594 (GRCm39) H211R probably benign Het
Pcsk5 A T 19: 17,424,938 (GRCm39) S1622T probably damaging Het
Pde10a A G 17: 9,117,702 (GRCm39) D26G probably damaging Het
Phf11a A T 14: 59,518,237 (GRCm39) L170H probably damaging Het
Ppil6 A G 10: 41,390,176 (GRCm39) D307G probably benign Het
Ppp6r2 A G 15: 89,137,254 (GRCm39) D6G possibly damaging Het
Psmd12 A T 11: 107,382,732 (GRCm39) K212N probably damaging Het
Rc3h1 T A 1: 160,786,993 (GRCm39) V796E probably benign Het
Rgl1 T C 1: 152,409,326 (GRCm39) Y503C probably damaging Het
Ryr1 A T 7: 28,801,163 (GRCm39) I860N probably damaging Het
Saal1 A T 7: 46,342,224 (GRCm39) N406K possibly damaging Het
Sh3pxd2a A T 19: 47,266,759 (GRCm39) Y277N probably damaging Het
Slitrk1 A T 14: 109,149,359 (GRCm39) Y451N probably damaging Het
Smad1 T C 8: 80,098,658 (GRCm39) E52G probably damaging Het
Smarcd1 A T 15: 99,605,519 (GRCm39) probably null Het
Smc3 A G 19: 53,613,496 (GRCm39) D403G probably benign Het
Srd5a2 A T 17: 74,328,476 (GRCm39) W201R probably damaging Het
Syt2 C A 1: 134,675,358 (GRCm39) A403D probably damaging Het
Tasor2 C T 13: 3,623,860 (GRCm39) S2030N possibly damaging Het
Tax1bp1 T A 6: 52,713,897 (GRCm39) S225R probably benign Het
Thap3 C T 4: 152,070,161 (GRCm39) V78M probably damaging Het
Thoc5 A G 11: 4,869,792 (GRCm39) K446R probably benign Het
Timmdc1 A C 16: 38,331,079 (GRCm39) probably null Het
Tmem126b G T 7: 90,125,179 (GRCm39) A2E probably damaging Het
Trim9 T A 12: 70,301,887 (GRCm39) R584W probably damaging Het
Vmn1r25 A T 6: 57,955,446 (GRCm39) I281N probably damaging Het
Wdr59 A G 8: 112,205,994 (GRCm39) F553S probably damaging Het
Wnt5a T C 14: 28,240,300 (GRCm39) M150T probably benign Het
Zfp53 A G 17: 21,729,766 (GRCm39) T600A probably damaging Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96,887,217 (GRCm39) missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96,926,048 (GRCm39) missense probably damaging 1.00
IGL00672:Fras1 APN 5 96,907,309 (GRCm39) splice site probably benign
IGL00772:Fras1 APN 5 96,783,971 (GRCm39) missense probably benign 0.42
IGL00844:Fras1 APN 5 96,682,712 (GRCm39) splice site probably benign
IGL00913:Fras1 APN 5 96,842,935 (GRCm39) missense probably damaging 0.99
IGL00959:Fras1 APN 5 96,929,140 (GRCm39) missense probably damaging 0.96
IGL00966:Fras1 APN 5 96,703,080 (GRCm39) missense probably benign 0.00
IGL01296:Fras1 APN 5 96,821,557 (GRCm39) missense probably null 0.58
IGL01307:Fras1 APN 5 96,929,551 (GRCm39) missense probably benign
IGL01481:Fras1 APN 5 96,805,100 (GRCm39) missense probably damaging 1.00
IGL01525:Fras1 APN 5 96,887,195 (GRCm39) missense probably damaging 0.99
IGL01599:Fras1 APN 5 96,857,750 (GRCm39) missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96,906,007 (GRCm39) missense probably benign 0.29
IGL01795:Fras1 APN 5 96,925,904 (GRCm39) missense probably damaging 1.00
IGL01867:Fras1 APN 5 96,735,990 (GRCm39) missense probably benign
IGL01869:Fras1 APN 5 96,856,642 (GRCm39) splice site probably benign
IGL01923:Fras1 APN 5 96,883,139 (GRCm39) missense probably damaging 1.00
IGL01982:Fras1 APN 5 96,887,107 (GRCm39) missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96,848,382 (GRCm39) missense probably benign
IGL02132:Fras1 APN 5 96,929,496 (GRCm39) nonsense probably null
IGL02171:Fras1 APN 5 96,883,040 (GRCm39) missense probably benign 0.15
IGL02213:Fras1 APN 5 96,793,730 (GRCm39) nonsense probably null
IGL02277:Fras1 APN 5 96,735,977 (GRCm39) missense probably benign 0.00
IGL02507:Fras1 APN 5 96,805,267 (GRCm39) missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96,917,372 (GRCm39) missense probably damaging 1.00
IGL02671:Fras1 APN 5 96,876,475 (GRCm39) missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96,692,883 (GRCm39) missense probably damaging 1.00
IGL02691:Fras1 APN 5 96,892,564 (GRCm39) missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96,839,230 (GRCm39) missense probably benign 0.35
IGL02836:Fras1 APN 5 96,682,725 (GRCm39) missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96,926,034 (GRCm39) missense probably damaging 1.00
IGL02998:Fras1 APN 5 96,850,040 (GRCm39) missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96,857,960 (GRCm39) missense probably benign
IGL03078:Fras1 APN 5 96,783,994 (GRCm39) missense probably damaging 1.00
IGL03096:Fras1 APN 5 96,912,760 (GRCm39) missense probably damaging 1.00
IGL03102:Fras1 APN 5 96,874,394 (GRCm39) missense probably benign 0.11
IGL03183:Fras1 APN 5 96,881,640 (GRCm39) splice site probably benign
IGL03189:Fras1 APN 5 96,890,930 (GRCm39) missense probably benign 0.00
IGL03193:Fras1 APN 5 96,925,965 (GRCm39) missense probably damaging 0.99
IGL03292:Fras1 APN 5 96,855,350 (GRCm39) missense probably damaging 1.00
IGL03328:Fras1 APN 5 96,929,619 (GRCm39) missense probably damaging 0.96
IGL03335:Fras1 APN 5 96,881,803 (GRCm39) splice site probably benign
IGL03394:Fras1 APN 5 96,815,336 (GRCm39) missense probably damaging 0.98
IGL03404:Fras1 APN 5 96,876,440 (GRCm39) missense probably damaging 0.99
baby_ruth UTSW 5 96,856,617 (GRCm39) missense probably benign 0.01
BB002:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
BB012:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
G1patch:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
I0000:Fras1 UTSW 5 96,888,688 (GRCm39) missense probably damaging 0.99
PIT4581001:Fras1 UTSW 5 96,703,160 (GRCm39) missense probably benign 0.01
R0028:Fras1 UTSW 5 96,825,175 (GRCm39) missense probably benign 0.07
R0049:Fras1 UTSW 5 96,924,481 (GRCm39) missense probably benign 0.07
R0049:Fras1 UTSW 5 96,924,481 (GRCm39) missense probably benign 0.07
R0099:Fras1 UTSW 5 96,762,776 (GRCm39) critical splice donor site probably null
R0109:Fras1 UTSW 5 96,857,936 (GRCm39) missense probably benign 0.01
R0158:Fras1 UTSW 5 96,924,493 (GRCm39) missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96,884,868 (GRCm39) missense probably damaging 0.99
R0305:Fras1 UTSW 5 96,744,747 (GRCm39) missense probably benign
R0352:Fras1 UTSW 5 96,874,399 (GRCm39) missense probably damaging 0.97
R0359:Fras1 UTSW 5 96,910,449 (GRCm39) missense probably damaging 0.98
R0371:Fras1 UTSW 5 96,703,190 (GRCm39) missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96,903,368 (GRCm39) nonsense probably null
R0395:Fras1 UTSW 5 96,917,512 (GRCm39) missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96,839,231 (GRCm39) missense probably benign 0.18
R0454:Fras1 UTSW 5 96,910,524 (GRCm39) missense probably damaging 0.96
R0456:Fras1 UTSW 5 96,862,202 (GRCm39) splice site probably null
R0456:Fras1 UTSW 5 96,702,647 (GRCm39) missense probably damaging 1.00
R0464:Fras1 UTSW 5 96,784,662 (GRCm39) missense probably damaging 0.98
R0613:Fras1 UTSW 5 96,848,347 (GRCm39) splice site probably benign
R0652:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96,815,246 (GRCm39) splice site probably benign
R0765:Fras1 UTSW 5 96,700,655 (GRCm39) missense probably benign 0.00
R0783:Fras1 UTSW 5 96,916,289 (GRCm39) missense probably damaging 1.00
R0811:Fras1 UTSW 5 96,900,857 (GRCm39) missense probably benign 0.35
R0812:Fras1 UTSW 5 96,900,857 (GRCm39) missense probably benign 0.35
R0943:Fras1 UTSW 5 96,874,402 (GRCm39) missense probably benign 0.00
R1037:Fras1 UTSW 5 96,862,322 (GRCm39) missense probably damaging 0.97
R1104:Fras1 UTSW 5 96,856,530 (GRCm39) missense probably benign 0.00
R1108:Fras1 UTSW 5 96,790,488 (GRCm39) missense probably damaging 0.99
R1332:Fras1 UTSW 5 96,855,167 (GRCm39) missense probably benign 0.00
R1336:Fras1 UTSW 5 96,855,167 (GRCm39) missense probably benign 0.00
R1458:Fras1 UTSW 5 96,748,592 (GRCm39) missense probably benign 0.00
R1495:Fras1 UTSW 5 96,676,445 (GRCm39) missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96,891,046 (GRCm39) missense probably benign 0.31
R1528:Fras1 UTSW 5 96,784,678 (GRCm39) missense probably damaging 0.99
R1532:Fras1 UTSW 5 96,861,855 (GRCm39) missense probably damaging 1.00
R1556:Fras1 UTSW 5 96,890,921 (GRCm39) missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96,857,837 (GRCm39) missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96,861,849 (GRCm39) missense probably damaging 1.00
R1645:Fras1 UTSW 5 96,848,445 (GRCm39) missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96,874,472 (GRCm39) critical splice donor site probably null
R1648:Fras1 UTSW 5 96,874,472 (GRCm39) critical splice donor site probably null
R1665:Fras1 UTSW 5 96,746,768 (GRCm39) missense probably damaging 1.00
R1682:Fras1 UTSW 5 96,793,732 (GRCm39) missense probably benign 0.00
R1701:Fras1 UTSW 5 96,748,643 (GRCm39) missense probably benign 0.00
R1716:Fras1 UTSW 5 96,700,584 (GRCm39) missense probably benign 0.10
R1718:Fras1 UTSW 5 96,702,748 (GRCm39) splice site probably null
R1800:Fras1 UTSW 5 96,857,741 (GRCm39) missense probably benign
R1806:Fras1 UTSW 5 96,912,835 (GRCm39) missense possibly damaging 0.88
R1806:Fras1 UTSW 5 96,861,829 (GRCm39) splice site probably benign
R1822:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1823:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1824:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1847:Fras1 UTSW 5 96,897,282 (GRCm39) splice site probably null
R1929:Fras1 UTSW 5 96,815,296 (GRCm39) missense probably benign 0.24
R1951:Fras1 UTSW 5 96,860,242 (GRCm39) missense probably benign 0.38
R2093:Fras1 UTSW 5 96,929,062 (GRCm39) missense probably damaging 1.00
R2283:Fras1 UTSW 5 96,802,164 (GRCm39) missense probably benign 0.10
R2884:Fras1 UTSW 5 96,848,127 (GRCm39) missense probably benign 0.07
R2913:Fras1 UTSW 5 96,881,774 (GRCm39) missense probably benign
R2914:Fras1 UTSW 5 96,881,774 (GRCm39) missense probably benign
R3054:Fras1 UTSW 5 96,912,802 (GRCm39) missense probably damaging 0.99
R3117:Fras1 UTSW 5 96,919,571 (GRCm39) missense probably damaging 1.00
R3118:Fras1 UTSW 5 96,919,571 (GRCm39) missense probably damaging 1.00
R3691:Fras1 UTSW 5 96,929,371 (GRCm39) missense probably benign 0.02
R3714:Fras1 UTSW 5 96,793,829 (GRCm39) critical splice donor site probably null
R3715:Fras1 UTSW 5 96,793,829 (GRCm39) critical splice donor site probably null
R3801:Fras1 UTSW 5 96,881,791 (GRCm39) missense probably benign 0.26
R3961:Fras1 UTSW 5 96,825,244 (GRCm39) critical splice donor site probably null
R4065:Fras1 UTSW 5 96,918,542 (GRCm39) missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96,918,542 (GRCm39) missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96,891,017 (GRCm39) missense probably damaging 1.00
R4124:Fras1 UTSW 5 96,918,512 (GRCm39) missense probably benign 0.05
R4127:Fras1 UTSW 5 96,918,512 (GRCm39) missense probably benign 0.05
R4153:Fras1 UTSW 5 96,924,594 (GRCm39) missense probably benign 0.17
R4233:Fras1 UTSW 5 96,862,235 (GRCm39) missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96,762,763 (GRCm39) missense probably benign 0.00
R4355:Fras1 UTSW 5 96,848,101 (GRCm39) missense probably benign
R4401:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4402:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4403:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4505:Fras1 UTSW 5 96,929,207 (GRCm39) missense probably damaging 1.00
R4548:Fras1 UTSW 5 96,857,754 (GRCm39) missense probably benign 0.00
R4559:Fras1 UTSW 5 96,929,148 (GRCm39) missense probably damaging 1.00
R4629:Fras1 UTSW 5 96,924,593 (GRCm39) missense probably benign 0.00
R4637:Fras1 UTSW 5 96,925,947 (GRCm39) missense probably damaging 1.00
R4678:Fras1 UTSW 5 96,848,427 (GRCm39) missense probably benign 0.13
R4707:Fras1 UTSW 5 96,883,097 (GRCm39) missense probably damaging 0.96
R4735:Fras1 UTSW 5 96,736,022 (GRCm39) missense probably benign 0.00
R4756:Fras1 UTSW 5 96,929,518 (GRCm39) missense probably benign 0.00
R4762:Fras1 UTSW 5 96,879,477 (GRCm39) missense probably benign
R4820:Fras1 UTSW 5 96,876,512 (GRCm39) missense probably benign 0.00
R4847:Fras1 UTSW 5 96,692,851 (GRCm39) missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96,926,018 (GRCm39) missense probably benign 0.00
R4909:Fras1 UTSW 5 96,856,617 (GRCm39) missense probably benign 0.01
R4931:Fras1 UTSW 5 96,784,699 (GRCm39) missense probably benign 0.02
R4938:Fras1 UTSW 5 96,924,583 (GRCm39) missense probably damaging 0.99
R4952:Fras1 UTSW 5 96,795,357 (GRCm39) missense probably benign 0.01
R4965:Fras1 UTSW 5 96,874,439 (GRCm39) missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96,798,541 (GRCm39) missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96,792,969 (GRCm39) missense probably damaging 1.00
R5168:Fras1 UTSW 5 96,856,616 (GRCm39) missense probably benign 0.00
R5182:Fras1 UTSW 5 96,784,032 (GRCm39) nonsense probably null
R5214:Fras1 UTSW 5 96,917,452 (GRCm39) missense probably damaging 1.00
R5220:Fras1 UTSW 5 96,916,222 (GRCm39) missense probably damaging 1.00
R5235:Fras1 UTSW 5 96,748,609 (GRCm39) missense probably benign 0.02
R5242:Fras1 UTSW 5 96,805,109 (GRCm39) missense probably benign 0.11
R5253:Fras1 UTSW 5 96,888,884 (GRCm39) missense probably damaging 0.99
R5260:Fras1 UTSW 5 96,883,046 (GRCm39) missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96,805,125 (GRCm39) missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96,793,019 (GRCm39) missense probably benign 0.00
R5467:Fras1 UTSW 5 96,927,912 (GRCm39) missense probably benign 0.04
R5543:Fras1 UTSW 5 96,676,394 (GRCm39) missense probably benign 0.01
R5555:Fras1 UTSW 5 96,825,236 (GRCm39) missense probably benign 0.34
R5602:Fras1 UTSW 5 96,884,880 (GRCm39) missense probably damaging 1.00
R5664:Fras1 UTSW 5 96,876,394 (GRCm39) missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96,929,203 (GRCm39) missense probably damaging 1.00
R5717:Fras1 UTSW 5 96,929,596 (GRCm39) missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96,916,240 (GRCm39) missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96,857,775 (GRCm39) missense probably benign 0.02
R5766:Fras1 UTSW 5 96,879,548 (GRCm39) missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96,793,807 (GRCm39) missense probably benign
R6052:Fras1 UTSW 5 96,912,725 (GRCm39) missense probably damaging 1.00
R6058:Fras1 UTSW 5 96,857,844 (GRCm39) missense probably benign
R6256:Fras1 UTSW 5 96,881,702 (GRCm39) missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96,912,805 (GRCm39) missense probably damaging 1.00
R6494:Fras1 UTSW 5 96,907,423 (GRCm39) missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96,905,953 (GRCm39) missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96,883,061 (GRCm39) missense probably damaging 1.00
R6725:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96,746,800 (GRCm39) missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96,746,800 (GRCm39) missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96,874,832 (GRCm39) missense probably damaging 0.99
R6841:Fras1 UTSW 5 96,876,410 (GRCm39) missense probably damaging 0.99
R6863:Fras1 UTSW 5 96,691,165 (GRCm39) missense probably benign 0.19
R6868:Fras1 UTSW 5 96,830,237 (GRCm39) missense probably benign 0.38
R6936:Fras1 UTSW 5 96,916,211 (GRCm39) missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96,762,732 (GRCm39) nonsense probably null
R7023:Fras1 UTSW 5 96,857,943 (GRCm39) missense probably benign 0.00
R7091:Fras1 UTSW 5 96,856,535 (GRCm39) missense probably benign
R7102:Fras1 UTSW 5 96,718,900 (GRCm39) missense probably benign
R7120:Fras1 UTSW 5 96,900,819 (GRCm39) nonsense probably null
R7124:Fras1 UTSW 5 96,862,260 (GRCm39) missense probably damaging 1.00
R7129:Fras1 UTSW 5 96,929,143 (GRCm39) missense probably benign 0.00
R7173:Fras1 UTSW 5 96,925,937 (GRCm39) missense probably damaging 1.00
R7174:Fras1 UTSW 5 96,903,436 (GRCm39) critical splice donor site probably null
R7185:Fras1 UTSW 5 96,784,635 (GRCm39) missense probably damaging 1.00
R7191:Fras1 UTSW 5 96,762,771 (GRCm39) missense probably benign 0.05
R7216:Fras1 UTSW 5 96,887,173 (GRCm39) missense probably damaging 1.00
R7222:Fras1 UTSW 5 96,784,668 (GRCm39) missense probably benign 0.00
R7222:Fras1 UTSW 5 96,784,045 (GRCm39) missense probably damaging 1.00
R7320:Fras1 UTSW 5 96,857,745 (GRCm39) missense probably benign 0.03
R7335:Fras1 UTSW 5 96,884,829 (GRCm39) missense possibly damaging 0.82
R7378:Fras1 UTSW 5 96,744,644 (GRCm39) missense probably damaging 0.98
R7394:Fras1 UTSW 5 96,860,309 (GRCm39) nonsense probably null
R7412:Fras1 UTSW 5 96,762,748 (GRCm39) missense probably benign 0.06
R7422:Fras1 UTSW 5 96,821,458 (GRCm39) missense probably benign 0.21
R7552:Fras1 UTSW 5 96,916,297 (GRCm39) missense probably damaging 1.00
R7559:Fras1 UTSW 5 96,888,713 (GRCm39) missense possibly damaging 0.82
R7575:Fras1 UTSW 5 96,691,173 (GRCm39) missense probably benign 0.02
R7578:Fras1 UTSW 5 96,832,296 (GRCm39) missense probably damaging 1.00
R7600:Fras1 UTSW 5 96,832,295 (GRCm39) missense probably damaging 1.00
R7669:Fras1 UTSW 5 96,840,483 (GRCm39) missense probably benign 0.01
R7710:Fras1 UTSW 5 96,792,962 (GRCm39) nonsense probably null
R7722:Fras1 UTSW 5 96,917,413 (GRCm39) missense probably damaging 1.00
R7726:Fras1 UTSW 5 96,860,310 (GRCm39) missense probably benign 0.41
R7745:Fras1 UTSW 5 96,874,754 (GRCm39) missense probably benign 0.11
R7777:Fras1 UTSW 5 96,900,763 (GRCm39) missense probably damaging 1.00
R7923:Fras1 UTSW 5 96,887,177 (GRCm39) missense probably damaging 1.00
R7925:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
R8000:Fras1 UTSW 5 96,910,536 (GRCm39) missense probably damaging 0.96
R8056:Fras1 UTSW 5 96,892,633 (GRCm39) missense probably damaging 1.00
R8058:Fras1 UTSW 5 96,842,778 (GRCm39) missense probably benign
R8117:Fras1 UTSW 5 96,855,245 (GRCm39) missense probably damaging 1.00
R8157:Fras1 UTSW 5 96,702,714 (GRCm39) missense probably benign 0.00
R8312:Fras1 UTSW 5 96,736,050 (GRCm39) missense probably benign
R8315:Fras1 UTSW 5 96,891,041 (GRCm39) missense probably damaging 0.97
R8412:Fras1 UTSW 5 96,744,711 (GRCm39) missense probably benign 0.00
R8546:Fras1 UTSW 5 96,857,825 (GRCm39) missense probably benign 0.00
R8705:Fras1 UTSW 5 96,839,260 (GRCm39) missense probably benign 0.01
R8790:Fras1 UTSW 5 96,903,236 (GRCm39) missense probably damaging 1.00
R8848:Fras1 UTSW 5 96,929,207 (GRCm39) missense probably damaging 1.00
R8855:Fras1 UTSW 5 96,917,465 (GRCm39) missense
R8871:Fras1 UTSW 5 96,855,257 (GRCm39) missense probably benign 0.34
R8894:Fras1 UTSW 5 96,907,402 (GRCm39) missense probably damaging 1.00
R8904:Fras1 UTSW 5 96,929,138 (GRCm39) missense probably benign 0.16
R8910:Fras1 UTSW 5 96,715,855 (GRCm39) missense probably benign 0.01
R8916:Fras1 UTSW 5 96,900,774 (GRCm39) missense probably damaging 1.00
R8929:Fras1 UTSW 5 96,917,366 (GRCm39) missense probably damaging 0.98
R8995:Fras1 UTSW 5 96,860,415 (GRCm39) missense possibly damaging 0.83
R9016:Fras1 UTSW 5 96,783,923 (GRCm39) missense probably damaging 0.96
R9021:Fras1 UTSW 5 96,888,609 (GRCm39) missense probably damaging 1.00
R9038:Fras1 UTSW 5 96,874,742 (GRCm39) missense probably benign 0.25
R9204:Fras1 UTSW 5 96,883,022 (GRCm39) missense probably damaging 1.00
R9222:Fras1 UTSW 5 96,805,087 (GRCm39) missense probably benign 0.15
R9231:Fras1 UTSW 5 96,692,904 (GRCm39) missense probably damaging 1.00
R9238:Fras1 UTSW 5 96,832,220 (GRCm39) missense possibly damaging 0.90
R9257:Fras1 UTSW 5 96,910,359 (GRCm39) missense probably damaging 1.00
R9302:Fras1 UTSW 5 96,682,751 (GRCm39) missense probably damaging 1.00
R9329:Fras1 UTSW 5 96,884,813 (GRCm39) missense probably damaging 1.00
R9361:Fras1 UTSW 5 96,924,557 (GRCm39) missense probably damaging 1.00
R9430:Fras1 UTSW 5 96,929,251 (GRCm39) missense probably benign 0.00
R9431:Fras1 UTSW 5 96,900,873 (GRCm39) missense possibly damaging 0.71
R9474:Fras1 UTSW 5 96,887,124 (GRCm39) missense probably benign 0.00
R9475:Fras1 UTSW 5 96,927,929 (GRCm39) missense probably damaging 0.96
R9497:Fras1 UTSW 5 96,884,895 (GRCm39) missense probably damaging 1.00
R9597:Fras1 UTSW 5 96,888,551 (GRCm39) missense probably damaging 1.00
R9650:Fras1 UTSW 5 96,910,387 (GRCm39) missense probably damaging 1.00
R9694:Fras1 UTSW 5 96,929,545 (GRCm39) missense probably benign 0.03
R9779:Fras1 UTSW 5 96,717,353 (GRCm39) missense probably damaging 0.99
Z1088:Fras1 UTSW 5 96,891,070 (GRCm39) missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1176:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1177:Fras1 UTSW 5 96,848,110 (GRCm39) missense possibly damaging 0.71
Z1177:Fras1 UTSW 5 96,839,316 (GRCm39) missense probably damaging 1.00
Z1177:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1177:Fras1 UTSW 5 96,888,842 (GRCm39) missense possibly damaging 0.95
Z1177:Fras1 UTSW 5 96,888,670 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGACCGTTCTGACAACATAGCCATC -3'
(R):5'- TCTGGCATTTGAACGTAGCCCATTC -3'

Sequencing Primer
(F):5'- ATAGCCATCTACCAACATGTCTTC -3'
(R):5'- GGATCTCAGGTTCACTAAGGATTCAG -3'
Posted On 2014-05-09