Mutagenetix > Incidental Mutation

Incidental Mutation 'R1661:Med13l'

186733

Institutional Source

Beutler Lab

Gene Symbol

Med13l

Ensembl Gene

ENSMUSG00000018076

Gene Name

mediator complex subunit 13-like

Synonyms

9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L

MMRRC Submission

039697-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R1661 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118560679-118765438 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118749748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1696 (W1696R)

Ref Sequence

ENSEMBL: ENSMUSP00000144092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000100816
AA Change: W1696R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: W1696R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	2.5e-116	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2197	1e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201010
AA Change: W1696R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: W1696R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	1e-112	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2206	1.7e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202787

Meta Mutation Damage Score

0.6500

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Cog2	T	C	8: 124,542,890	F390L	probably benign	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fnip2	A	G	3: 79,515,149	F108S	probably benign	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Kpna6	T	A	4: 129,657,471	R80S	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Rgl1	T	C	1: 152,533,575	Y503C	probably damaging	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Slitrk1	A	T	14: 108,911,927	Y451N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Med13l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Med13l	APN	5	118724071	missense	probably damaging	0.99
IGL01012:Med13l	APN	5	118734028	missense	probably damaging	0.99
IGL01316:Med13l	APN	5	118762781	missense	probably damaging	1.00
IGL01529:Med13l	APN	5	118742335	missense	probably damaging	1.00
IGL01731:Med13l	APN	5	118742407	missense	probably benign	0.05
IGL01790:Med13l	APN	5	118593522	missense	probably damaging	1.00
IGL02394:Med13l	APN	5	118748833	missense	probably benign	0.37
IGL02432:Med13l	APN	5	118738400	missense	possibly damaging	0.90
IGL02698:Med13l	APN	5	118762829	missense	probably damaging	0.99
IGL02801:Med13l	APN	5	118745113	missense	probably damaging	1.00
IGL03242:Med13l	APN	5	118747445	missense	probably benign
IGL03270:Med13l	APN	5	118731430	missense	probably damaging	1.00
Basics	UTSW	5	118759264	critical splice donor site	probably null
firmament	UTSW	5	118745006	splice site	probably null
Fundament	UTSW	5	118721474	missense	probably damaging	1.00
Root	UTSW	5	118593445	missense	probably damaging	1.00
P0035:Med13l	UTSW	5	118742620	missense	probably benign	0.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0136:Med13l	UTSW	5	118724050	missense	probably benign	0.15
R0158:Med13l	UTSW	5	118742449	missense	unknown
R0197:Med13l	UTSW	5	118671002	splice site	probably benign
R0370:Med13l	UTSW	5	118741826	missense	probably benign	0.14
R0492:Med13l	UTSW	5	118738495	missense	probably damaging	1.00
R0532:Med13l	UTSW	5	118759123	missense	possibly damaging	0.78
R0726:Med13l	UTSW	5	118748684	missense	probably damaging	0.99
R0738:Med13l	UTSW	5	118751633	missense	probably damaging	0.99
R0827:Med13l	UTSW	5	118726247	splice site	probably benign
R0883:Med13l	UTSW	5	118671002	splice site	probably benign
R0959:Med13l	UTSW	5	118754285	missense	possibly damaging	0.89
R1458:Med13l	UTSW	5	118738459	missense	probably benign	0.00
R1562:Med13l	UTSW	5	118738519	missense	probably damaging	1.00
R1577:Med13l	UTSW	5	118721392	missense	probably damaging	1.00
R1665:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1720:Med13l	UTSW	5	118741995	missense	probably damaging	1.00
R1929:Med13l	UTSW	5	118728833	missense	probably benign	0.01
R1967:Med13l	UTSW	5	118761322	missense	probably damaging	0.99
R2301:Med13l	UTSW	5	118593447	missense	probably damaging	1.00
R3691:Med13l	UTSW	5	118721497	missense	probably benign	0.16
R3895:Med13l	UTSW	5	118761323	missense	probably null	0.99
R4043:Med13l	UTSW	5	118593463	missense	probably damaging	1.00
R4593:Med13l	UTSW	5	118742560	missense	probably damaging	1.00
R4902:Med13l	UTSW	5	118745130	missense	probably damaging	1.00
R4995:Med13l	UTSW	5	118730949	missense	possibly damaging	0.90
R5010:Med13l	UTSW	5	118593550	missense	possibly damaging	0.95
R5057:Med13l	UTSW	5	118718493	missense	probably damaging	1.00
R5369:Med13l	UTSW	5	118724010	missense	probably benign	0.02
R5446:Med13l	UTSW	5	118742397	missense	possibly damaging	0.81
R5564:Med13l	UTSW	5	118742040	missense	probably damaging	1.00
R5566:Med13l	UTSW	5	118728665	missense	possibly damaging	0.95
R5580:Med13l	UTSW	5	118751630	missense	possibly damaging	0.95
R5634:Med13l	UTSW	5	118560850	missense	possibly damaging	0.88
R5748:Med13l	UTSW	5	118593445	missense	probably damaging	1.00
R5764:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R5765:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R6083:Med13l	UTSW	5	118721486	missense	possibly damaging	0.80
R6504:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R6546:Med13l	UTSW	5	118721474	missense	probably damaging	1.00
R6797:Med13l	UTSW	5	118759264	critical splice donor site	probably null
R6911:Med13l	UTSW	5	118755658	missense	possibly damaging	0.95
R6942:Med13l	UTSW	5	118745006	splice site	probably null
R7018:Med13l	UTSW	5	118751986	missense	probably damaging	0.99
R7096:Med13l	UTSW	5	118721926	missense	possibly damaging	0.90
R7113:Med13l	UTSW	5	118726265	missense	probably benign	0.09
R7136:Med13l	UTSW	5	118721522	missense	possibly damaging	0.90
R7140:Med13l	UTSW	5	118741972	missense	probably benign	0.27
R7345:Med13l	UTSW	5	118742760	missense	probably damaging	1.00
R7409:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R7410:Med13l	UTSW	5	118560832	missense	possibly damaging	0.94
R7432:Med13l	UTSW	5	118751938	missense	probably damaging	0.99
R7486:Med13l	UTSW	5	118728474	missense	probably benign	0.17
R7509:Med13l	UTSW	5	118748930	missense	probably damaging	0.97
R7722:Med13l	UTSW	5	118747407	missense	probably benign	0.32
R7802:Med13l	UTSW	5	118728590	missense	probably benign	0.03
R8081:Med13l	UTSW	5	118728268	missense	probably damaging	1.00
R8260:Med13l	UTSW	5	118748729	missense	possibly damaging	0.95
R8266:Med13l	UTSW	5	118742109	missense	probably damaging	1.00
R8347:Med13l	UTSW	5	118742597	missense	probably benign
R8365:Med13l	UTSW	5	118728644	missense	possibly damaging	0.81
R8508:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R8920:Med13l	UTSW	5	118747478	nonsense	probably null
R8970:Med13l	UTSW	5	118745099	missense	probably damaging	1.00
R8994:Med13l	UTSW	5	118728161	missense	possibly damaging	0.78
R9045:Med13l	UTSW	5	118742751	missense	probably benign
R9401:Med13l	UTSW	5	118745024	missense	probably benign	0.14
R9445:Med13l	UTSW	5	118724149	missense	probably benign	0.00
R9446:Med13l	UTSW	5	118738502	missense	probably benign	0.11
R9714:Med13l	UTSW	5	118728373	missense	probably benign	0.44
R9777:Med13l	UTSW	5	118748959	missense	probably benign
R9781:Med13l	UTSW	5	118729967	missense	possibly damaging	0.60
R9797:Med13l	UTSW	5	118742079	missense	probably damaging	1.00
X0065:Med13l	UTSW	5	118729883	missense	probably damaging	1.00
Z1088:Med13l	UTSW	5	118749641	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCCAAGACCCTGAGTTGTGAGTG -3'
(R):5'- ACTATGGCATCCTAAAGGAGCCCTG -3'

Sequencing Primer
(F):5'- ATGCATTGGATCATAGCCCG -3'
(R):5'- TGCTCTCCACAGGCTAATGG -3'

Posted On

2014-05-09