Incidental Mutation 'R1661:Asprv1'
ID 186739
Institutional Source Beutler Lab
Gene Symbol Asprv1
Ensembl Gene ENSMUSG00000033508
Gene Name aspartic peptidase, retroviral-like 1
Synonyms TPA-induced aspartic proteinase-like, Taps, 2300003P22Rik, SASP, SASPase
MMRRC Submission 039697-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1661 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 86605216-86606692 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86605718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 188 (N188S)
Ref Sequence ENSEMBL: ENSMUSP00000046121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043400]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043400
AA Change: N188S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046121
Gene: ENSMUSG00000033508
AA Change: N188S

DomainStartEndE-ValueType
Pfam:Asp_protease 177 295 1.3e-8 PFAM
Pfam:Asp_protease_2 196 286 1.6e-10 PFAM
low complexity region 314 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele develop fine skin wrinkles at the side of their body without any apparent epidermal differentiation defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,596,816 (GRCm39) G423E probably damaging Het
Acox3 A T 5: 35,760,371 (GRCm39) H429L probably damaging Het
Adamts9 G T 6: 92,857,604 (GRCm39) Q895K possibly damaging Het
Ajm1 T C 2: 25,469,167 (GRCm39) D248G possibly damaging Het
Amotl2 T A 9: 102,607,295 (GRCm39) I701N probably damaging Het
Angel2 T C 1: 190,669,664 (GRCm39) Y115H probably damaging Het
Appbp2 T C 11: 85,100,936 (GRCm39) probably null Het
Arhgap33 A C 7: 30,231,748 (GRCm39) C113W probably damaging Het
Atp8a2 T C 14: 60,097,635 (GRCm39) I798V possibly damaging Het
Caml C A 13: 55,779,784 (GRCm39) L286I probably benign Het
Ccdc125 A G 13: 100,830,081 (GRCm39) I284V probably benign Het
Cep89 A G 7: 35,117,105 (GRCm39) T236A possibly damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Cog2 T C 8: 125,269,629 (GRCm39) F390L probably benign Het
Creg2 C T 1: 39,662,372 (GRCm39) W253* probably null Het
Cttnbp2 A T 6: 18,434,982 (GRCm39) I292K probably benign Het
Ddb1 A T 19: 10,606,444 (GRCm39) Y1114F probably benign Het
Dnah6 T C 6: 73,101,761 (GRCm39) E1921G probably benign Het
Dync1h1 T C 12: 110,622,791 (GRCm39) F3494L probably damaging Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Fam222b A G 11: 78,045,987 (GRCm39) Y388C probably damaging Het
Fam227a G A 15: 79,504,878 (GRCm39) probably null Het
Fbxo32 A C 15: 58,054,865 (GRCm39) V156G probably damaging Het
Fem1b C T 9: 62,704,556 (GRCm39) V235I probably damaging Het
Fnip2 A G 3: 79,422,456 (GRCm39) F108S probably benign Het
Fras1 A T 5: 96,746,768 (GRCm39) S613C probably damaging Het
Garin1a G C 6: 29,285,937 (GRCm39) R132P probably damaging Het
Gm7276 C A 18: 77,273,266 (GRCm39) probably benign Het
Gnb4 A C 3: 32,644,188 (GRCm39) L152* probably null Het
Hsd17b4 G A 18: 50,293,282 (GRCm39) E274K probably benign Het
Htr4 T C 18: 62,545,305 (GRCm39) I30T probably damaging Het
Ighmbp2 A G 19: 3,317,246 (GRCm39) L542P probably damaging Het
Ikzf2 T A 1: 69,577,973 (GRCm39) Y512F probably damaging Het
Itpr1 A G 6: 108,459,858 (GRCm39) N2051D probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klhl22 C A 16: 17,594,352 (GRCm39) D160E probably benign Het
Kpna6 T A 4: 129,551,264 (GRCm39) R80S probably benign Het
Lclat1 A G 17: 73,494,999 (GRCm39) E142G probably damaging Het
Lrig3 T C 10: 125,833,570 (GRCm39) Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map1b T A 13: 99,568,437 (GRCm39) N1428I unknown Het
Map3k19 T A 1: 127,745,393 (GRCm39) T1354S possibly damaging Het
Med13l T A 5: 118,887,813 (GRCm39) W1696R probably damaging Het
Megf8 A G 7: 25,063,272 (GRCm39) T2543A probably damaging Het
Mfn1 T G 3: 32,588,471 (GRCm39) V66G probably benign Het
Muc15 C T 2: 110,564,243 (GRCm39) Q260* probably null Het
Nfkb1 T C 3: 135,300,718 (GRCm39) H616R probably damaging Het
Nnmt A G 9: 48,516,174 (GRCm39) S29P probably benign Het
Nrde2 A T 12: 100,116,119 (GRCm39) S122T probably benign Het
Or10a2 T C 7: 106,673,481 (GRCm39) S149P probably damaging Het
Or4g16 T C 2: 111,137,116 (GRCm39) C189R probably damaging Het
Or7g33 C T 9: 19,448,624 (GRCm39) V201I probably benign Het
Pced1b A G 15: 97,282,594 (GRCm39) H211R probably benign Het
Pcsk5 A T 19: 17,424,938 (GRCm39) S1622T probably damaging Het
Pde10a A G 17: 9,117,702 (GRCm39) D26G probably damaging Het
Phf11a A T 14: 59,518,237 (GRCm39) L170H probably damaging Het
Ppil6 A G 10: 41,390,176 (GRCm39) D307G probably benign Het
Ppp6r2 A G 15: 89,137,254 (GRCm39) D6G possibly damaging Het
Psmd12 A T 11: 107,382,732 (GRCm39) K212N probably damaging Het
Rc3h1 T A 1: 160,786,993 (GRCm39) V796E probably benign Het
Rgl1 T C 1: 152,409,326 (GRCm39) Y503C probably damaging Het
Ryr1 A T 7: 28,801,163 (GRCm39) I860N probably damaging Het
Saal1 A T 7: 46,342,224 (GRCm39) N406K possibly damaging Het
Sh3pxd2a A T 19: 47,266,759 (GRCm39) Y277N probably damaging Het
Slitrk1 A T 14: 109,149,359 (GRCm39) Y451N probably damaging Het
Smad1 T C 8: 80,098,658 (GRCm39) E52G probably damaging Het
Smarcd1 A T 15: 99,605,519 (GRCm39) probably null Het
Smc3 A G 19: 53,613,496 (GRCm39) D403G probably benign Het
Srd5a2 A T 17: 74,328,476 (GRCm39) W201R probably damaging Het
Syt2 C A 1: 134,675,358 (GRCm39) A403D probably damaging Het
Tasor2 C T 13: 3,623,860 (GRCm39) S2030N possibly damaging Het
Tax1bp1 T A 6: 52,713,897 (GRCm39) S225R probably benign Het
Thap3 C T 4: 152,070,161 (GRCm39) V78M probably damaging Het
Thoc5 A G 11: 4,869,792 (GRCm39) K446R probably benign Het
Timmdc1 A C 16: 38,331,079 (GRCm39) probably null Het
Tmem126b G T 7: 90,125,179 (GRCm39) A2E probably damaging Het
Trim9 T A 12: 70,301,887 (GRCm39) R584W probably damaging Het
Vmn1r25 A T 6: 57,955,446 (GRCm39) I281N probably damaging Het
Wdr59 A G 8: 112,205,994 (GRCm39) F553S probably damaging Het
Wnt5a T C 14: 28,240,300 (GRCm39) M150T probably benign Het
Zfp53 A G 17: 21,729,766 (GRCm39) T600A probably damaging Het
Other mutations in Asprv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Asprv1 APN 6 86,605,900 (GRCm39) missense probably damaging 0.99
quince UTSW 6 86,605,822 (GRCm39) missense probably damaging 1.00
R0254:Asprv1 UTSW 6 86,606,077 (GRCm39) missense probably damaging 1.00
R0311:Asprv1 UTSW 6 86,605,822 (GRCm39) missense probably damaging 1.00
R1538:Asprv1 UTSW 6 86,605,618 (GRCm39) nonsense probably null
R1792:Asprv1 UTSW 6 86,605,354 (GRCm39) missense possibly damaging 0.59
R2964:Asprv1 UTSW 6 86,605,348 (GRCm39) missense probably damaging 0.98
R2965:Asprv1 UTSW 6 86,605,348 (GRCm39) missense probably damaging 0.98
R2966:Asprv1 UTSW 6 86,605,348 (GRCm39) missense probably damaging 0.98
R4748:Asprv1 UTSW 6 86,605,405 (GRCm39) missense probably damaging 0.98
R5600:Asprv1 UTSW 6 86,606,044 (GRCm39) nonsense probably null
R5655:Asprv1 UTSW 6 86,605,464 (GRCm39) missense probably benign 0.05
R5704:Asprv1 UTSW 6 86,605,532 (GRCm39) missense probably damaging 1.00
R5715:Asprv1 UTSW 6 86,605,596 (GRCm39) missense probably benign
R6259:Asprv1 UTSW 6 86,605,361 (GRCm39) missense probably benign 0.05
R6899:Asprv1 UTSW 6 86,605,742 (GRCm39) missense probably damaging 1.00
R7451:Asprv1 UTSW 6 86,605,930 (GRCm39) missense probably benign 0.00
R7593:Asprv1 UTSW 6 86,605,762 (GRCm39) missense probably damaging 0.99
R7648:Asprv1 UTSW 6 86,605,852 (GRCm39) missense probably damaging 1.00
R8425:Asprv1 UTSW 6 86,605,851 (GRCm39) missense probably benign 0.15
R8775:Asprv1 UTSW 6 86,605,321 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Asprv1 UTSW 6 86,605,321 (GRCm39) missense probably damaging 1.00
R8882:Asprv1 UTSW 6 86,605,349 (GRCm39) missense probably benign 0.02
R9091:Asprv1 UTSW 6 86,606,077 (GRCm39) missense probably damaging 1.00
R9270:Asprv1 UTSW 6 86,606,077 (GRCm39) missense probably damaging 1.00
Z1177:Asprv1 UTSW 6 86,605,326 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACCAAACTGAGGTTCCTGAAAG -3'
(R):5'- TGTCTTGCCCAGGCTAATTTCTGTG -3'

Sequencing Primer
(F):5'- TTCCTGAAAGAGTCGCTCAAG -3'
(R):5'- AGGCTAATTTCTGTGTCCCAC -3'
Posted On 2014-05-09