Incidental Mutation 'R1661:Adamts9'
ID186741
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92880623 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 895 (Q895K)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113434] [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably benign
Transcript: ENSMUST00000113434
Predicted Effect possibly damaging
Transcript: ENSMUST00000113438
AA Change: Q895K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: Q895K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167391
AA Change: Q314K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: Q314K

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Smc3 A G 19: 53,625,065 D403G probably benign Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4402001:Adamts9 UTSW 6 92872347 missense probably benign
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92937338 missense probably benign 0.00
R7682:Adamts9 UTSW 6 92880698 missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92796238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGTGTGACCTGACATGACC -3'
(R):5'- AGGCCAGCAGACTTCTTCCCAATC -3'

Sequencing Primer
(F):5'- TGTGACCTGACATGACCTGAATC -3'
(R):5'- ATCTCTCCACACATTGCAGGTG -3'
Posted On2014-05-09