Incidental Mutation 'R1661:Ryr1'
ID 186744
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms calcium release channel isoform 1, Ryr, skrr
MMRRC Submission 039697-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1661 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 28702765-28824599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28801163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 860 (I860N)
Ref Sequence ENSEMBL: ENSMUSP00000032813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032813
AA Change: I860N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: I860N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: I860N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: I860N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: I867N

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,596,816 (GRCm39) G423E probably damaging Het
Acox3 A T 5: 35,760,371 (GRCm39) H429L probably damaging Het
Adamts9 G T 6: 92,857,604 (GRCm39) Q895K possibly damaging Het
Ajm1 T C 2: 25,469,167 (GRCm39) D248G possibly damaging Het
Amotl2 T A 9: 102,607,295 (GRCm39) I701N probably damaging Het
Angel2 T C 1: 190,669,664 (GRCm39) Y115H probably damaging Het
Appbp2 T C 11: 85,100,936 (GRCm39) probably null Het
Arhgap33 A C 7: 30,231,748 (GRCm39) C113W probably damaging Het
Asprv1 A G 6: 86,605,718 (GRCm39) N188S probably damaging Het
Atp8a2 T C 14: 60,097,635 (GRCm39) I798V possibly damaging Het
Caml C A 13: 55,779,784 (GRCm39) L286I probably benign Het
Ccdc125 A G 13: 100,830,081 (GRCm39) I284V probably benign Het
Cep89 A G 7: 35,117,105 (GRCm39) T236A possibly damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Cog2 T C 8: 125,269,629 (GRCm39) F390L probably benign Het
Creg2 C T 1: 39,662,372 (GRCm39) W253* probably null Het
Cttnbp2 A T 6: 18,434,982 (GRCm39) I292K probably benign Het
Ddb1 A T 19: 10,606,444 (GRCm39) Y1114F probably benign Het
Dnah6 T C 6: 73,101,761 (GRCm39) E1921G probably benign Het
Dync1h1 T C 12: 110,622,791 (GRCm39) F3494L probably damaging Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Fam222b A G 11: 78,045,987 (GRCm39) Y388C probably damaging Het
Fam227a G A 15: 79,504,878 (GRCm39) probably null Het
Fbxo32 A C 15: 58,054,865 (GRCm39) V156G probably damaging Het
Fem1b C T 9: 62,704,556 (GRCm39) V235I probably damaging Het
Fnip2 A G 3: 79,422,456 (GRCm39) F108S probably benign Het
Fras1 A T 5: 96,746,768 (GRCm39) S613C probably damaging Het
Garin1a G C 6: 29,285,937 (GRCm39) R132P probably damaging Het
Gm7276 C A 18: 77,273,266 (GRCm39) probably benign Het
Gnb4 A C 3: 32,644,188 (GRCm39) L152* probably null Het
Hsd17b4 G A 18: 50,293,282 (GRCm39) E274K probably benign Het
Htr4 T C 18: 62,545,305 (GRCm39) I30T probably damaging Het
Ighmbp2 A G 19: 3,317,246 (GRCm39) L542P probably damaging Het
Ikzf2 T A 1: 69,577,973 (GRCm39) Y512F probably damaging Het
Itpr1 A G 6: 108,459,858 (GRCm39) N2051D probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klhl22 C A 16: 17,594,352 (GRCm39) D160E probably benign Het
Kpna6 T A 4: 129,551,264 (GRCm39) R80S probably benign Het
Lclat1 A G 17: 73,494,999 (GRCm39) E142G probably damaging Het
Lrig3 T C 10: 125,833,570 (GRCm39) Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map1b T A 13: 99,568,437 (GRCm39) N1428I unknown Het
Map3k19 T A 1: 127,745,393 (GRCm39) T1354S possibly damaging Het
Med13l T A 5: 118,887,813 (GRCm39) W1696R probably damaging Het
Megf8 A G 7: 25,063,272 (GRCm39) T2543A probably damaging Het
Mfn1 T G 3: 32,588,471 (GRCm39) V66G probably benign Het
Muc15 C T 2: 110,564,243 (GRCm39) Q260* probably null Het
Nfkb1 T C 3: 135,300,718 (GRCm39) H616R probably damaging Het
Nnmt A G 9: 48,516,174 (GRCm39) S29P probably benign Het
Nrde2 A T 12: 100,116,119 (GRCm39) S122T probably benign Het
Or10a2 T C 7: 106,673,481 (GRCm39) S149P probably damaging Het
Or4g16 T C 2: 111,137,116 (GRCm39) C189R probably damaging Het
Or7g33 C T 9: 19,448,624 (GRCm39) V201I probably benign Het
Pced1b A G 15: 97,282,594 (GRCm39) H211R probably benign Het
Pcsk5 A T 19: 17,424,938 (GRCm39) S1622T probably damaging Het
Pde10a A G 17: 9,117,702 (GRCm39) D26G probably damaging Het
Phf11a A T 14: 59,518,237 (GRCm39) L170H probably damaging Het
Ppil6 A G 10: 41,390,176 (GRCm39) D307G probably benign Het
Ppp6r2 A G 15: 89,137,254 (GRCm39) D6G possibly damaging Het
Psmd12 A T 11: 107,382,732 (GRCm39) K212N probably damaging Het
Rc3h1 T A 1: 160,786,993 (GRCm39) V796E probably benign Het
Rgl1 T C 1: 152,409,326 (GRCm39) Y503C probably damaging Het
Saal1 A T 7: 46,342,224 (GRCm39) N406K possibly damaging Het
Sh3pxd2a A T 19: 47,266,759 (GRCm39) Y277N probably damaging Het
Slitrk1 A T 14: 109,149,359 (GRCm39) Y451N probably damaging Het
Smad1 T C 8: 80,098,658 (GRCm39) E52G probably damaging Het
Smarcd1 A T 15: 99,605,519 (GRCm39) probably null Het
Smc3 A G 19: 53,613,496 (GRCm39) D403G probably benign Het
Srd5a2 A T 17: 74,328,476 (GRCm39) W201R probably damaging Het
Syt2 C A 1: 134,675,358 (GRCm39) A403D probably damaging Het
Tasor2 C T 13: 3,623,860 (GRCm39) S2030N possibly damaging Het
Tax1bp1 T A 6: 52,713,897 (GRCm39) S225R probably benign Het
Thap3 C T 4: 152,070,161 (GRCm39) V78M probably damaging Het
Thoc5 A G 11: 4,869,792 (GRCm39) K446R probably benign Het
Timmdc1 A C 16: 38,331,079 (GRCm39) probably null Het
Tmem126b G T 7: 90,125,179 (GRCm39) A2E probably damaging Het
Trim9 T A 12: 70,301,887 (GRCm39) R584W probably damaging Het
Vmn1r25 A T 6: 57,955,446 (GRCm39) I281N probably damaging Het
Wdr59 A G 8: 112,205,994 (GRCm39) F553S probably damaging Het
Wnt5a T C 14: 28,240,300 (GRCm39) M150T probably benign Het
Zfp53 A G 17: 21,729,766 (GRCm39) T600A probably damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 28,802,235 (GRCm39) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 28,824,385 (GRCm39) splice site probably null
IGL00427:Ryr1 APN 7 28,804,162 (GRCm39) splice site probably benign
IGL00559:Ryr1 APN 7 28,711,667 (GRCm39) splice site probably benign
IGL00803:Ryr1 APN 7 28,769,070 (GRCm39) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 28,723,654 (GRCm39) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 28,719,620 (GRCm39) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 28,781,968 (GRCm39) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 28,799,627 (GRCm39) splice site probably benign
IGL01385:Ryr1 APN 7 28,756,410 (GRCm39) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 28,751,762 (GRCm39) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 28,774,652 (GRCm39) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 28,790,501 (GRCm39) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 28,778,022 (GRCm39) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 28,759,235 (GRCm39) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 28,771,083 (GRCm39) missense probably benign 0.16
IGL02152:Ryr1 APN 7 28,751,440 (GRCm39) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 28,793,472 (GRCm39) missense probably benign 0.07
IGL02321:Ryr1 APN 7 28,778,121 (GRCm39) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 28,804,491 (GRCm39) splice site probably benign
IGL02472:Ryr1 APN 7 28,740,269 (GRCm39) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 28,815,024 (GRCm39) missense probably benign 0.24
IGL02666:Ryr1 APN 7 28,719,188 (GRCm39) missense unknown
IGL02672:Ryr1 APN 7 28,703,944 (GRCm39) unclassified probably benign
IGL02677:Ryr1 APN 7 28,810,033 (GRCm39) missense probably benign 0.18
IGL02686:Ryr1 APN 7 28,768,975 (GRCm39) splice site probably benign
IGL02751:Ryr1 APN 7 28,778,199 (GRCm39) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 28,748,220 (GRCm39) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 28,760,965 (GRCm39) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 28,796,884 (GRCm39) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 28,759,478 (GRCm39) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 28,743,318 (GRCm39) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 28,770,084 (GRCm39) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 28,782,911 (GRCm39) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 28,804,018 (GRCm39) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 28,774,624 (GRCm39) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 28,802,389 (GRCm39) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 28,715,211 (GRCm39) missense unknown
IGL03146:Ryr1 APN 7 28,793,457 (GRCm39) missense probably benign 0.09
IGL03165:Ryr1 APN 7 28,804,465 (GRCm39) missense probably benign 0.22
IGL03220:Ryr1 APN 7 28,759,280 (GRCm39) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 28,746,967 (GRCm39) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0069:Ryr1 UTSW 7 28,809,930 (GRCm39) splice site probably benign
R0148:Ryr1 UTSW 7 28,751,460 (GRCm39) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 28,767,013 (GRCm39) splice site probably benign
R0387:Ryr1 UTSW 7 28,782,792 (GRCm39) splice site probably benign
R0454:Ryr1 UTSW 7 28,735,500 (GRCm39) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 28,703,218 (GRCm39) splice site probably benign
R0533:Ryr1 UTSW 7 28,778,205 (GRCm39) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 28,735,501 (GRCm39) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 28,804,220 (GRCm39) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 28,774,034 (GRCm39) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 28,799,614 (GRCm39) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 28,709,122 (GRCm39) missense unknown
R1052:Ryr1 UTSW 7 28,795,683 (GRCm39) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 28,785,534 (GRCm39) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 28,815,437 (GRCm39) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 28,770,046 (GRCm39) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 28,782,962 (GRCm39) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 28,791,600 (GRCm39) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 28,761,616 (GRCm39) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 28,794,915 (GRCm39) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 28,793,686 (GRCm39) missense probably benign 0.03
R1665:Ryr1 UTSW 7 28,735,503 (GRCm39) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 28,815,579 (GRCm39) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 28,777,989 (GRCm39) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 28,746,928 (GRCm39) missense probably benign 0.25
R1720:Ryr1 UTSW 7 28,801,295 (GRCm39) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 28,767,046 (GRCm39) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 28,779,236 (GRCm39) missense probably benign 0.43
R1860:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1861:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1921:Ryr1 UTSW 7 28,754,369 (GRCm39) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 28,758,897 (GRCm39) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 28,759,056 (GRCm39) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 28,789,575 (GRCm39) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 28,767,867 (GRCm39) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 28,719,166 (GRCm39) missense unknown
R2291:Ryr1 UTSW 7 28,798,202 (GRCm39) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 28,774,718 (GRCm39) missense probably benign 0.18
R2512:Ryr1 UTSW 7 28,802,967 (GRCm39) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 28,735,551 (GRCm39) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 28,708,987 (GRCm39) missense unknown
R2885:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 28,778,166 (GRCm39) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 28,745,071 (GRCm39) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 28,774,373 (GRCm39) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 28,769,075 (GRCm39) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 28,719,577 (GRCm39) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 28,772,327 (GRCm39) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 28,794,549 (GRCm39) missense probably benign 0.41
R4041:Ryr1 UTSW 7 28,785,356 (GRCm39) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 28,761,576 (GRCm39) nonsense probably null
R4257:Ryr1 UTSW 7 28,781,875 (GRCm39) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 28,782,484 (GRCm39) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 28,793,667 (GRCm39) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 28,789,581 (GRCm39) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 28,798,160 (GRCm39) missense probably benign 0.05
R4554:Ryr1 UTSW 7 28,804,433 (GRCm39) missense probably benign 0.03
R4562:Ryr1 UTSW 7 28,774,005 (GRCm39) intron probably benign
R4642:Ryr1 UTSW 7 28,785,463 (GRCm39) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 28,759,256 (GRCm39) missense probably null 0.99
R4707:Ryr1 UTSW 7 28,745,087 (GRCm39) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 28,785,258 (GRCm39) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 28,704,246 (GRCm39) unclassified probably benign
R4770:Ryr1 UTSW 7 28,808,707 (GRCm39) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 28,794,522 (GRCm39) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 28,719,408 (GRCm39) missense unknown
R4933:Ryr1 UTSW 7 28,803,723 (GRCm39) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 28,767,520 (GRCm39) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 28,768,998 (GRCm39) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 28,778,208 (GRCm39) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 28,768,540 (GRCm39) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5013:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5137:Ryr1 UTSW 7 28,801,283 (GRCm39) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 28,767,118 (GRCm39) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 28,735,553 (GRCm39) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 28,815,023 (GRCm39) missense probably benign 0.03
R5303:Ryr1 UTSW 7 28,767,907 (GRCm39) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 28,816,841 (GRCm39) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 28,809,237 (GRCm39) missense probably benign 0.39
R5460:Ryr1 UTSW 7 28,771,386 (GRCm39) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 28,723,448 (GRCm39) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 28,768,453 (GRCm39) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 28,785,610 (GRCm39) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 28,715,148 (GRCm39) missense unknown
R5575:Ryr1 UTSW 7 28,778,118 (GRCm39) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 28,811,399 (GRCm39) missense probably benign 0.05
R5658:Ryr1 UTSW 7 28,790,514 (GRCm39) splice site probably null
R5918:Ryr1 UTSW 7 28,708,577 (GRCm39) missense probably benign 0.39
R5926:Ryr1 UTSW 7 28,803,785 (GRCm39) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 28,746,290 (GRCm39) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 28,815,552 (GRCm39) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 28,771,349 (GRCm39) missense probably null 0.98
R5991:Ryr1 UTSW 7 28,804,035 (GRCm39) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 28,767,062 (GRCm39) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 28,723,666 (GRCm39) missense probably benign 0.38
R6075:Ryr1 UTSW 7 28,786,863 (GRCm39) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 28,771,398 (GRCm39) missense probably benign 0.01
R6126:Ryr1 UTSW 7 28,775,664 (GRCm39) missense probably null 1.00
R6147:Ryr1 UTSW 7 28,785,339 (GRCm39) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 28,815,606 (GRCm39) missense probably benign 0.07
R6279:Ryr1 UTSW 7 28,786,853 (GRCm39) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 28,774,682 (GRCm39) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 28,759,120 (GRCm39) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 28,776,503 (GRCm39) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 28,715,079 (GRCm39) missense probably benign 0.39
R6514:Ryr1 UTSW 7 28,746,266 (GRCm39) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 28,794,917 (GRCm39) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 28,737,770 (GRCm39) critical splice donor site probably null
R6746:Ryr1 UTSW 7 28,816,829 (GRCm39) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 28,764,299 (GRCm39) missense probably benign 0.12
R6800:Ryr1 UTSW 7 28,723,741 (GRCm39) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 28,751,751 (GRCm39) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 28,808,812 (GRCm39) missense probably benign 0.03
R6995:Ryr1 UTSW 7 28,793,607 (GRCm39) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 28,803,068 (GRCm39) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 28,746,279 (GRCm39) missense probably benign 0.37
R7238:Ryr1 UTSW 7 28,794,807 (GRCm39) missense probably benign 0.24
R7240:Ryr1 UTSW 7 28,751,440 (GRCm39) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 28,758,936 (GRCm39) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 28,785,180 (GRCm39) missense probably benign 0.05
R7403:Ryr1 UTSW 7 28,713,292 (GRCm39) missense probably benign 0.34
R7422:Ryr1 UTSW 7 28,785,295 (GRCm39) missense probably benign 0.00
R7493:Ryr1 UTSW 7 28,794,630 (GRCm39) missense probably benign 0.44
R7570:Ryr1 UTSW 7 28,778,010 (GRCm39) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 28,735,528 (GRCm39) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 28,798,210 (GRCm39) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 28,767,055 (GRCm39) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 28,804,257 (GRCm39) missense probably benign 0.39
R7799:Ryr1 UTSW 7 28,702,985 (GRCm39) splice site probably null
R7916:Ryr1 UTSW 7 28,790,364 (GRCm39) nonsense probably null
R7922:Ryr1 UTSW 7 28,796,649 (GRCm39) missense probably benign 0.09
R7988:Ryr1 UTSW 7 28,795,596 (GRCm39) missense probably benign 0.29
R7997:Ryr1 UTSW 7 28,702,968 (GRCm39) missense unknown
R8052:Ryr1 UTSW 7 28,782,810 (GRCm39) missense probably benign 0.05
R8096:Ryr1 UTSW 7 28,708,626 (GRCm39) missense unknown
R8116:Ryr1 UTSW 7 28,810,308 (GRCm39) missense probably benign 0.03
R8202:Ryr1 UTSW 7 28,790,457 (GRCm39) missense probably benign 0.18
R8207:Ryr1 UTSW 7 28,789,650 (GRCm39) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 28,768,546 (GRCm39) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 28,764,064 (GRCm39) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8454:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8487:Ryr1 UTSW 7 28,740,292 (GRCm39) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 28,769,509 (GRCm39) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 28,704,239 (GRCm39) unclassified probably benign
R8678:Ryr1 UTSW 7 28,776,489 (GRCm39) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 28,751,753 (GRCm39) missense probably benign 0.03
R8724:Ryr1 UTSW 7 28,816,802 (GRCm39) missense probably benign 0.04
R8755:Ryr1 UTSW 7 28,791,693 (GRCm39) missense probably benign 0.19
R8772:Ryr1 UTSW 7 28,815,557 (GRCm39) missense probably benign 0.05
R8790:Ryr1 UTSW 7 28,776,297 (GRCm39) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 28,764,284 (GRCm39) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 28,774,091 (GRCm39) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 28,808,638 (GRCm39) missense probably benign 0.00
R8910:Ryr1 UTSW 7 28,771,340 (GRCm39) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 28,789,640 (GRCm39) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 28,801,358 (GRCm39) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 28,790,422 (GRCm39) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 28,803,989 (GRCm39) nonsense probably null
R9123:Ryr1 UTSW 7 28,771,229 (GRCm39) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 28,769,283 (GRCm39) missense probably benign 0.08
R9189:Ryr1 UTSW 7 28,776,471 (GRCm39) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 28,794,524 (GRCm39) missense probably benign 0.00
R9214:Ryr1 UTSW 7 28,785,187 (GRCm39) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 28,801,277 (GRCm39) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 28,743,313 (GRCm39) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 28,751,813 (GRCm39) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 28,802,254 (GRCm39) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 28,802,389 (GRCm39) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 28,717,387 (GRCm39) missense unknown
R9333:Ryr1 UTSW 7 28,774,214 (GRCm39) critical splice donor site probably null
R9459:Ryr1 UTSW 7 28,768,068 (GRCm39) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 28,772,510 (GRCm39) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 28,777,965 (GRCm39) missense probably benign 0.15
R9524:Ryr1 UTSW 7 28,723,600 (GRCm39) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 28,715,138 (GRCm39) missense unknown
R9664:Ryr1 UTSW 7 28,759,092 (GRCm39) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 28,774,664 (GRCm39) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 28,760,956 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,802,923 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,785,460 (GRCm39) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 28,719,639 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,801,347 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,748,217 (GRCm39) nonsense probably null
Z1177:Ryr1 UTSW 7 28,717,410 (GRCm39) missense unknown
Z1186:Ryr1 UTSW 7 28,781,902 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCAGAACTTCGTACACATCAGGCAA -3'
(R):5'- TCCATGCCATGAAGCTGTGCTC -3'

Sequencing Primer
(F):5'- ccacacccccagtctctc -3'
(R):5'- ATGAAGCTGTGCTCCCTCG -3'
Posted On 2014-05-09