Mutagenetix > Incidental Mutations

Incidental Mutation 'R1661:Cog2'

186756

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

039697-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1661 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124542890 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 390 (F390L)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460
AA Change: F390L

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: F390L

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fnip2	A	G	3: 79,515,149	F108S	probably benign	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Kpna6	T	A	4: 129,657,471	R80S	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Med13l	T	A	5: 118,749,748	W1696R	probably damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Rgl1	T	C	1: 152,533,575	Y503C	probably damaging	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Slitrk1	A	T	14: 108,911,927	Y451N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GCCAAGCGGCTTTCTGTGTCTTAG -3'
(R):5'- CCAGTGTCCTTACTGCACAAATCCC -3'

Sequencing Primer
(F):5'- TGAGCTGCTACTACACAGTG -3'
(R):5'- CACAAATCCCTGTGTGGTGG -3'

Posted On

2014-05-09