Incidental Mutation 'R1661:Map1b'
ID 186775
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 039697-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1661 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99568437 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1428 (N1428I)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: N1428I
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: N1428I

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,596,816 (GRCm39) G423E probably damaging Het
Acox3 A T 5: 35,760,371 (GRCm39) H429L probably damaging Het
Adamts9 G T 6: 92,857,604 (GRCm39) Q895K possibly damaging Het
Ajm1 T C 2: 25,469,167 (GRCm39) D248G possibly damaging Het
Amotl2 T A 9: 102,607,295 (GRCm39) I701N probably damaging Het
Angel2 T C 1: 190,669,664 (GRCm39) Y115H probably damaging Het
Appbp2 T C 11: 85,100,936 (GRCm39) probably null Het
Arhgap33 A C 7: 30,231,748 (GRCm39) C113W probably damaging Het
Asprv1 A G 6: 86,605,718 (GRCm39) N188S probably damaging Het
Atp8a2 T C 14: 60,097,635 (GRCm39) I798V possibly damaging Het
Caml C A 13: 55,779,784 (GRCm39) L286I probably benign Het
Ccdc125 A G 13: 100,830,081 (GRCm39) I284V probably benign Het
Cep89 A G 7: 35,117,105 (GRCm39) T236A possibly damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Cog2 T C 8: 125,269,629 (GRCm39) F390L probably benign Het
Creg2 C T 1: 39,662,372 (GRCm39) W253* probably null Het
Cttnbp2 A T 6: 18,434,982 (GRCm39) I292K probably benign Het
Ddb1 A T 19: 10,606,444 (GRCm39) Y1114F probably benign Het
Dnah6 T C 6: 73,101,761 (GRCm39) E1921G probably benign Het
Dync1h1 T C 12: 110,622,791 (GRCm39) F3494L probably damaging Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Fam222b A G 11: 78,045,987 (GRCm39) Y388C probably damaging Het
Fam227a G A 15: 79,504,878 (GRCm39) probably null Het
Fbxo32 A C 15: 58,054,865 (GRCm39) V156G probably damaging Het
Fem1b C T 9: 62,704,556 (GRCm39) V235I probably damaging Het
Fnip2 A G 3: 79,422,456 (GRCm39) F108S probably benign Het
Fras1 A T 5: 96,746,768 (GRCm39) S613C probably damaging Het
Garin1a G C 6: 29,285,937 (GRCm39) R132P probably damaging Het
Gm7276 C A 18: 77,273,266 (GRCm39) probably benign Het
Gnb4 A C 3: 32,644,188 (GRCm39) L152* probably null Het
Hsd17b4 G A 18: 50,293,282 (GRCm39) E274K probably benign Het
Htr4 T C 18: 62,545,305 (GRCm39) I30T probably damaging Het
Ighmbp2 A G 19: 3,317,246 (GRCm39) L542P probably damaging Het
Ikzf2 T A 1: 69,577,973 (GRCm39) Y512F probably damaging Het
Itpr1 A G 6: 108,459,858 (GRCm39) N2051D probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klhl22 C A 16: 17,594,352 (GRCm39) D160E probably benign Het
Kpna6 T A 4: 129,551,264 (GRCm39) R80S probably benign Het
Lclat1 A G 17: 73,494,999 (GRCm39) E142G probably damaging Het
Lrig3 T C 10: 125,833,570 (GRCm39) Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map3k19 T A 1: 127,745,393 (GRCm39) T1354S possibly damaging Het
Med13l T A 5: 118,887,813 (GRCm39) W1696R probably damaging Het
Megf8 A G 7: 25,063,272 (GRCm39) T2543A probably damaging Het
Mfn1 T G 3: 32,588,471 (GRCm39) V66G probably benign Het
Muc15 C T 2: 110,564,243 (GRCm39) Q260* probably null Het
Nfkb1 T C 3: 135,300,718 (GRCm39) H616R probably damaging Het
Nnmt A G 9: 48,516,174 (GRCm39) S29P probably benign Het
Nrde2 A T 12: 100,116,119 (GRCm39) S122T probably benign Het
Or10a2 T C 7: 106,673,481 (GRCm39) S149P probably damaging Het
Or4g16 T C 2: 111,137,116 (GRCm39) C189R probably damaging Het
Or7g33 C T 9: 19,448,624 (GRCm39) V201I probably benign Het
Pced1b A G 15: 97,282,594 (GRCm39) H211R probably benign Het
Pcsk5 A T 19: 17,424,938 (GRCm39) S1622T probably damaging Het
Pde10a A G 17: 9,117,702 (GRCm39) D26G probably damaging Het
Phf11a A T 14: 59,518,237 (GRCm39) L170H probably damaging Het
Ppil6 A G 10: 41,390,176 (GRCm39) D307G probably benign Het
Ppp6r2 A G 15: 89,137,254 (GRCm39) D6G possibly damaging Het
Psmd12 A T 11: 107,382,732 (GRCm39) K212N probably damaging Het
Rc3h1 T A 1: 160,786,993 (GRCm39) V796E probably benign Het
Rgl1 T C 1: 152,409,326 (GRCm39) Y503C probably damaging Het
Ryr1 A T 7: 28,801,163 (GRCm39) I860N probably damaging Het
Saal1 A T 7: 46,342,224 (GRCm39) N406K possibly damaging Het
Sh3pxd2a A T 19: 47,266,759 (GRCm39) Y277N probably damaging Het
Slitrk1 A T 14: 109,149,359 (GRCm39) Y451N probably damaging Het
Smad1 T C 8: 80,098,658 (GRCm39) E52G probably damaging Het
Smarcd1 A T 15: 99,605,519 (GRCm39) probably null Het
Smc3 A G 19: 53,613,496 (GRCm39) D403G probably benign Het
Srd5a2 A T 17: 74,328,476 (GRCm39) W201R probably damaging Het
Syt2 C A 1: 134,675,358 (GRCm39) A403D probably damaging Het
Tasor2 C T 13: 3,623,860 (GRCm39) S2030N possibly damaging Het
Tax1bp1 T A 6: 52,713,897 (GRCm39) S225R probably benign Het
Thap3 C T 4: 152,070,161 (GRCm39) V78M probably damaging Het
Thoc5 A G 11: 4,869,792 (GRCm39) K446R probably benign Het
Timmdc1 A C 16: 38,331,079 (GRCm39) probably null Het
Tmem126b G T 7: 90,125,179 (GRCm39) A2E probably damaging Het
Trim9 T A 12: 70,301,887 (GRCm39) R584W probably damaging Het
Vmn1r25 A T 6: 57,955,446 (GRCm39) I281N probably damaging Het
Wdr59 A G 8: 112,205,994 (GRCm39) F553S probably damaging Het
Wnt5a T C 14: 28,240,300 (GRCm39) M150T probably benign Het
Zfp53 A G 17: 21,729,766 (GRCm39) T600A probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAACTTGTAGCCACAGAGGCAGTAG -3'
(R):5'- TGAAAAGCCACAGGCAGTTCCAG -3'

Sequencing Primer
(F):5'- GACTTGTCTGAAACAGTGCC -3'
(R):5'- AGGCAGTTCCAGTGAGCTTTG -3'
Posted On 2014-05-09