Mutagenetix > Incidental Mutation

Incidental Mutation 'R1661:Slitrk1'

186780

Institutional Source

Beutler Lab

Gene Symbol

Slitrk1

Ensembl Gene

ENSMUSG00000075478

Gene Name

SLIT and NTRK-like family, member 1

Synonyms

3200001I04Rik

MMRRC Submission

039697-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1661 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108908800-108914158 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108911927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 451 (Y451N)

Ref Sequence

ENSEMBL: ENSMUSP00000097897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100322]

AlphaFold

Q810C1

Predicted Effect

probably damaging
Transcript: ENSMUST00000100322
AA Change: Y451N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000097897
Gene: ENSMUSG00000075478
AA Change: Y451N

Domain	Start	End	E-Value	Type
LRR	81	104	1.37e2	SMART
LRR	105	128	1.37e1	SMART
LRR	129	152	4.57e0	SMART
LRR_TYP	153	176	2.75e-3	SMART
LRR	180	200	1.92e2	SMART
LRRCT	212	262	3.45e-5	SMART
LRRNT	340	376	4.28e0	SMART
LRR	374	397	1.86e1	SMART
LRR	398	421	1.49e1	SMART
LRR	422	445	2.68e1	SMART
LRR	446	469	4.98e-1	SMART
LRR_TYP	470	493	6.52e-5	SMART
LRR	494	517	3.46e2	SMART
LRRCT	529	579	3.91e-4	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. This protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity, reduced male body weight, elevated anxiety- and depression-like behavior, increased norepinephrine content in brain, and partial postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,377,842	G423E	probably damaging	Het
Acox3	A	T	5: 35,603,027	H429L	probably damaging	Het
Adamts9	G	T	6: 92,880,623	Q895K	possibly damaging	Het
Amotl2	T	A	9: 102,730,096	I701N	probably damaging	Het
Angel2	T	C	1: 190,937,467	Y115H	probably damaging	Het
Appbp2	T	C	11: 85,210,110		probably null	Het
Arhgap33	A	C	7: 30,532,323	C113W	probably damaging	Het
Asprv1	A	G	6: 86,628,736	N188S	probably damaging	Het
Atp8a2	T	C	14: 59,860,186	I798V	possibly damaging	Het
Caml	C	A	13: 55,631,971	L286I	probably benign	Het
Ccdc125	A	G	13: 100,693,573	I284V	probably benign	Het
Cep89	A	G	7: 35,417,680	T236A	possibly damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Cog2	T	C	8: 124,542,890	F390L	probably benign	Het
Creg2	C	T	1: 39,623,204	W253*	probably null	Het
Cttnbp2	A	T	6: 18,434,983	I292K	probably benign	Het
Ddb1	A	T	19: 10,629,080	Y1114F	probably benign	Het
Dnah6	T	C	6: 73,124,778	E1921G	probably benign	Het
Dync1h1	T	C	12: 110,656,357	F3494L	probably damaging	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Fam208b	C	T	13: 3,573,860	S2030N	possibly damaging	Het
Fam222b	A	G	11: 78,155,161	Y388C	probably damaging	Het
Fam227a	G	A	15: 79,620,677		probably null	Het
Fam71f2	G	C	6: 29,285,938	R132P	probably damaging	Het
Fbxo32	A	C	15: 58,191,469	V156G	probably damaging	Het
Fem1b	C	T	9: 62,797,274	V235I	probably damaging	Het
Fnip2	A	G	3: 79,515,149	F108S	probably benign	Het
Fras1	A	T	5: 96,598,909	S613C	probably damaging	Het
Gm7276	C	A	18: 77,185,570		probably benign	Het
Gm996	T	C	2: 25,579,155	D248G	possibly damaging	Het
Gnb4	A	C	3: 32,590,039	L152*	probably null	Het
Hsd17b4	G	A	18: 50,160,215	E274K	probably benign	Het
Htr4	T	C	18: 62,412,234	I30T	probably damaging	Het
Ighmbp2	A	G	19: 3,267,246	L542P	probably damaging	Het
Ikzf2	T	A	1: 69,538,814	Y512F	probably damaging	Het
Itpr1	A	G	6: 108,482,897	N2051D	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klhl22	C	A	16: 17,776,488	D160E	probably benign	Het
Kpna6	T	A	4: 129,657,471	R80S	probably benign	Het
Lclat1	A	G	17: 73,188,004	E142G	probably damaging	Het
Lrig3	T	C	10: 125,997,701	Y349H	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1b	T	A	13: 99,431,929	N1428I	unknown	Het
Map3k19	T	A	1: 127,817,656	T1354S	possibly damaging	Het
Med13l	T	A	5: 118,749,748	W1696R	probably damaging	Het
Megf8	A	G	7: 25,363,847	T2543A	probably damaging	Het
Mfn1	T	G	3: 32,534,322	V66G	probably benign	Het
Muc15	C	T	2: 110,733,898	Q260*	probably null	Het
Nfkb1	T	C	3: 135,594,957	H616R	probably damaging	Het
Nnmt	A	G	9: 48,604,874	S29P	probably benign	Het
Nrde2	A	T	12: 100,149,860	S122T	probably benign	Het
Olfr1279	T	C	2: 111,306,771	C189R	probably damaging	Het
Olfr714	T	C	7: 107,074,274	S149P	probably damaging	Het
Olfr853	C	T	9: 19,537,328	V201I	probably benign	Het
Pced1b	A	G	15: 97,384,713	H211R	probably benign	Het
Pcsk5	A	T	19: 17,447,574	S1622T	probably damaging	Het
Pde10a	A	G	17: 8,898,870	D26G	probably damaging	Het
Phf11a	A	T	14: 59,280,788	L170H	probably damaging	Het
Ppil6	A	G	10: 41,514,180	D307G	probably benign	Het
Ppp6r2	A	G	15: 89,253,051	D6G	possibly damaging	Het
Psmd12	A	T	11: 107,491,906	K212N	probably damaging	Het
Rc3h1	T	A	1: 160,959,423	V796E	probably benign	Het
Rgl1	T	C	1: 152,533,575	Y503C	probably damaging	Het
Ryr1	A	T	7: 29,101,738	I860N	probably damaging	Het
Saal1	A	T	7: 46,692,800	N406K	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,278,320	Y277N	probably damaging	Het
Smad1	T	C	8: 79,372,029	E52G	probably damaging	Het
Smarcd1	A	T	15: 99,707,638		probably null	Het
Smc3	A	G	19: 53,625,065	D403G	probably benign	Het
Srd5a2	A	T	17: 74,021,481	W201R	probably damaging	Het
Syt2	C	A	1: 134,747,620	A403D	probably damaging	Het
Tax1bp1	T	A	6: 52,736,912	S225R	probably benign	Het
Thap3	C	T	4: 151,985,704	V78M	probably damaging	Het
Thoc5	A	G	11: 4,919,792	K446R	probably benign	Het
Timmdc1	A	C	16: 38,510,717		probably null	Het
Tmem126b	G	T	7: 90,475,971	A2E	probably damaging	Het
Trim9	T	A	12: 70,255,113	R584W	probably damaging	Het
Vmn1r25	A	T	6: 57,978,461	I281N	probably damaging	Het
Wdr59	A	G	8: 111,479,362	F553S	probably damaging	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Zfp53	A	G	17: 21,509,504	T600A	probably damaging	Het

Other mutations in Slitrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Slitrk1	APN	14	108911837	missense	probably damaging	1.00
IGL00949:Slitrk1	APN	14	108911809	missense	probably damaging	0.98
IGL01556:Slitrk1	APN	14	108913018	missense	probably damaging	1.00
IGL01924:Slitrk1	APN	14	108911239	missense	probably benign	0.08
IGL02389:Slitrk1	APN	14	108912322	missense	probably benign
IGL02619:Slitrk1	APN	14	108911917	missense	probably benign	0.09
IGL02828:Slitrk1	APN	14	108911616	missense	possibly damaging	0.63
R0070:Slitrk1	UTSW	14	108913317	start gained	probably benign
R0135:Slitrk1	UTSW	14	108911629	missense	probably benign	0.00
R0627:Slitrk1	UTSW	14	108912239	missense	probably damaging	1.00
R1529:Slitrk1	UTSW	14	108913277	start codon destroyed	probably benign	0.33
R1711:Slitrk1	UTSW	14	108913096	missense	probably benign	0.21
R1960:Slitrk1	UTSW	14	108912190	missense	probably damaging	0.96
R1961:Slitrk1	UTSW	14	108912190	missense	probably damaging	0.96
R4247:Slitrk1	UTSW	14	108912562	missense	possibly damaging	0.95
R4394:Slitrk1	UTSW	14	108911303	missense	probably benign	0.01
R5027:Slitrk1	UTSW	14	108912308	missense	probably benign
R5241:Slitrk1	UTSW	14	108913012	missense	probably benign	0.27
R5599:Slitrk1	UTSW	14	108911812	missense	probably benign	0.00
R5835:Slitrk1	UTSW	14	108911572	missense	possibly damaging	0.94
R6224:Slitrk1	UTSW	14	108912022	missense	probably damaging	1.00
R6489:Slitrk1	UTSW	14	108911303	missense	possibly damaging	0.63
R6504:Slitrk1	UTSW	14	108911697	missense	probably benign	0.14
R7102:Slitrk1	UTSW	14	108912629	missense	probably benign	0.01
R7346:Slitrk1	UTSW	14	108913159	missense	possibly damaging	0.89
R7413:Slitrk1	UTSW	14	108911925	nonsense	probably null
R8005:Slitrk1	UTSW	14	108913265	missense	probably benign	0.30
R8258:Slitrk1	UTSW	14	108911221	missense	probably benign	0.05
R8259:Slitrk1	UTSW	14	108911221	missense	probably benign	0.05
R8906:Slitrk1	UTSW	14	108911707	missense	probably damaging	0.99
R9136:Slitrk1	UTSW	14	108911549	missense
R9150:Slitrk1	UTSW	14	108911669	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTGCCCATTGCTTGAAAGGCAC -3'
(R):5'- TGAACTGTAACAACCGGAACGTGAG -3'

Sequencing Primer
(F):5'- GTTAACTGGTCCAGCACCC -3'
(R):5'- TAAGCTTTCCAACGTGCAGG -3'

Posted On

2014-05-09