Incidental Mutation 'R1661:Pde10a'
ID186787
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8898870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 26 (D26G)
Ref Sequence ENSEMBL: ENSMUSP00000138135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115722] [ENSMUST00000115724] [ENSMUST00000231430]
Predicted Effect probably benign
Transcript: ENSMUST00000024647
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: D26G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: D26G

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115717
AA Change: D26G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: D9G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: D9G

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115722
AA Change: D61G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: D80G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: D80G

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141877
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: D308G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Adamts9 G T 6: 92,880,623 Q895K possibly damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Smc3 A G 19: 53,625,065 D403G probably benign Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTGCTAAGGTAGAATGCCATCC -3'
(R):5'- ACGTTCGCTCTAAACTCAGTGCTC -3'

Sequencing Primer
(F):5'- GGTAGAATGCCATCCTAGCATTTG -3'
(R):5'- TAAACTCAGTGCTCGCTCAG -3'
Posted On2014-05-09